Labshake search
Citations for Takara Bio :
4751 - 4800 of 4901 citations for Uridine Triphosphate UTP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 3µg of DNA was digested by EcoRI and the digested DNA was self-ligated using DNA Ligation Kit (Mighty Mix; Takara Bio, Kusatsu, Japan) after purification by ethanol precipitation ...
-
bioRxiv - Plant Biology 2023Quote: ... Each one or two PCR fragments were inserted into pMpGWB300 that was cleaved by HindIII and SalI using the In-Fusion Cloning kit (TaKaRa Bio, Kusatsu, Japan) to generate pMpGWB300:proMpRKD:MpRKD and pMpGWB300:proMpRKD:mMpRKD plasmids.
-
bioRxiv - Plant Biology 2023Quote: ... cDNA from a microgram of RNA was obtained using a PrimeScript RT reagent kit (Perfect Real Time, Takara Bio Inc., Otsu, Shiga, Japan) following its instructions ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA was removed from 1 μg purified RNA using gDNA Eraser (PrimeScript RT Reagent Kit, Perfect Real Time) following manufacturer’s instructions (Takara Bio Inc., Kusatsu, Japan). Reverse transcription and cDNA was synthesized using PrimeScript Reverse Transcriptase (TaKaRa Bio) ...
-
bioRxiv - Genetics 2024Quote: 1 µg of gDNA Eraser-treated RNA was reverse transcribed into cDNA using the PrimeScrip® RT reagent Kit with gDNA Eraser (Takara Bio, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 ng of total RNA was used as input for the SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio USA. Inc), which converts poly(A ...
-
bioRxiv - Neuroscience 2024Quote: Library preparation and RNA sequencing were performed by Novogene Co using the SMART-Seq v4 PLUS Kit (Takara Bio, Kusatsu, Shiga, Japan, # R400752). Total RNA was reverse transcribed into the first-strand cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification of the fragments and their subsequent ligation was performed using the In-Fusion cloning kit and online tools (BD Clontech, Takara Bio, USA), or they were synthesized by GenScript (Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: A total of 250 pg to 10 ng RNA per sample was used as input material for sequencing libraries (1–500 ng for small RNA libraries) using the SMARTer Stranded Total RNA-Seq Kit V2 (Takara Bio USA, Inc.) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse-transcription and amplification were performed using the One Step PrimeScript™ RT-PCR Kit (RR064A, Takara Bio Inc., Kusatsu, JP-25, Japan) with the following forward primer (5’-ATGAGYCTTYTAACCGAGGTCGAAACG-3’ ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was reverse transcribed from 1 μg of total RNA using the PrimeScriptTM RT reagent kit (AK4201; Takara Bio, Kusatsu, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... A first-strand cDNA was obtained from 1 μg of total RNA using a PrimeScript® RT reagent kit (Takara Bio, Inc., Otsu, Japan). The sequences of candidate genes were obtained from the local alkaligrass EST database using a BLASTn program ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng of RNA was used to prepare cDNA sequencing libraries with the Clontech SMARTer Stranded Total RNA-Seq kit (Pico Input) with ribosomal cDNA depletion (Takara Bio USA, Cat #634413). Prepared libraries were submitted to paired-end 100 bp sequencing on a NovaSeq 6000 system at the YCGA ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA carrying full-length transcript information was synthesized with SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (TaKaRa Bio, Japan) followed by Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first-strand cDNA was synthesized with 1 μg of total RNA using a PrimeScript™ 1st Strand cDNA Synthesis Kit with gDNA Eraser (TaKaRa Biotechnology, Dalian, China). For sequencing analysis of the PxRdls ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lentiviral supernatant titers were determined by Lenti-X p24 Rapid Titer Kit (supplemental Table 1) according to manufacturer’s protocol (Takara Bio USA, Inc. California, U.S.A).
-
bioRxiv - Plant Biology 2019Quote: ... strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech, Saint Germain-en-Laye, France). The 3’ ends were amplified using forward internal and polyA-anchored LD primers (Table S1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR product was cloned into pcDNA6/luc/NP3 into a NotI-AgeI site using the Clontech In-Fusion kit (Clontech Laboratories, Mountain View, CA). To remove the two putative MIR211 sites ...
-
bioRxiv - Genomics 2019Quote: ... PCR products were collected by centrifugation at ~2250 xg for 20 min using the supplied SMARTer ICELL8 Collection Kit (Takara Bio USA, Cat.#640048).
-
bioRxiv - Microbiology 2019Quote: ... and then cloned into the pC003 vector by replacing the shahiiCas13a locus using the In-Fusion HD Cloning Kit (Takara Bio, Inc., Shiga, Japan), and then kanamycin resistant gene of the vector was replaced by kanamycin-resistant gene (aphA-3 ...
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis H >A of the HPGG motif of the Cyt-b5 domain was either performed by Genescript (N. benthamiana) or using In-Fusion® HD cloning kit (Takara Bio, Kusatsu, Japan) for Synechocystis after amplification using two mutagenic complementary primers for amplifying pTHT2031-Ot5H46A-S and pTHT2031-Ot10H20A-S from pTHT2031-Ot5-S and pTHT2031-Ot10-S ...
-
bioRxiv - Genomics 2021Quote: Sequencing libraries were prepared with 50ng input RNA material using SMARTer Stranded Total RNA-seq Kit v2—Pico Input Mammalian (Takara Bio USA Inc., USA), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... full length double stranded cDNA (dscDNA) was generated using the SMART-Seq version 4 Ultra Low Input kit (Takara Bio USA, Mountain View, CA) and the Nextera XT DNA Library Preparation kit (Illumina) ...
-
bioRxiv - Bioengineering 2020Quote: ... we generated the pAAVS1-HITI-tdT-Fluc2-Oatp1a1-MC (HITI-MC) parental plasmid using the In-Fusion cloning kit from Clontech (Takara Bio, California, USA). Using restriction enzyme digestion ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR fragments were directly cloned into the PacI-linearized expression vectors (pNBI16, pNBI21, or pNBI22) using the In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). Insert sequences were verified by sequencing (Eurofins ...
-
bioRxiv - Microbiology 2020Quote: ... the V3-V4 regions of the 16S rRNA gene were amplified using a 16S (V3–V4) Metagenomic Library Construction Kit for NGS (Takara Bio Inc, Kusatsu, Japan). The following primers were used (16S rRNA gene-specific sequences are underlined) ...
-
bioRxiv - Plant Biology 2021Quote: ... after which it was used as the template for synthesizing cDNA using the PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara Bio, Beijing, China). The full-length ZmCd1 cDNA was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase (Vazyme Biotech) ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was normalized to 2ng in a total volume of 9μl and then transcribed to cDNA in a dedicated PCR clean workstation using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio, Mountain View, CA). Sequencing libraries were constructed from cDNA using the SMARTer ThruPLEX DNA-Seq kit (Takara Bio) ...
-
bioRxiv - Biophysics 2022Quote: ... We obtained cDNA from poly(A) RNA of each sample using a SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio Inc., Shiga, Japan), following the manufacturer’s instructions ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The α1-subunit genes were inserted at the PH promoter of vectors already containing the corresponding β1-subunit proteins using In-Fusion® HD Cloning Kit (Takara Bio, USA Inc.) and control sequenced ...
-
bioRxiv - Genomics 2022Quote: ... For the Rubicon Genomics ThruPLEX® DNA-seq Kit: High Performance Library Preparation for Illumina® NGS Platforms (currently available from Takara Bio USA), the manufacturer’s protocol was followed.
-
bioRxiv - Biophysics 2022Quote: ... and V2HeR1 was subcloned into a peGFP-P2A vector or pCaMKIIa-eGFP-P2A vector using an In-Fusion HD cloning kit (Takara Bio, Inc., Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Molecular Biology 2020Quote: ... The next two RNA-seq experiments utilized the SMARTer Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio Inc., Kusatsu, Shiga, JP), and were sequenced on the NovaSeq 6000 (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... Ribosomal RNA was removed from total RNA and libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 (Takara Bio Inc, Shiga, Japan). Samples were sequenced on the NovaSEQ6000 platform on a S4 flow cell using 151-bp paired-end reads at Genomics Shared Resource ...
-
bioRxiv - Neuroscience 2021Quote: Single nuclei library preparation was performed by the MIT BioMicro Center using the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (Takara Bio Inc) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The 5’ end of RiMCO1 was verified by rapid amplification of cDNA ends (RACE) using the SMART RACE cDNA amplification kit (Clontech, Palo Alto, CA, USA), the RiMCO1-specific primer GiFETa.rR (Table S2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion and point mutation constructs were produced through inverse PCR using Takara In-Fusion HD cloning kit (#638920) (Takara Bio Inc., Kusatsu, Shiga, Japan). Primers used are listed in supplementary materials.
-
bioRxiv - Cell Biology 2019Quote: ... The cDNA was synthesized by reverse transcription using 1 μg of total RNA as a template with a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, Beijing, China, RR047A). The SYBR® Premix Ex Taq TM II kit (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was isolated from ten individual mites using Trizol® reagent and was then treated with a PrimeScript™ RT synthesis kit with genomic gDNA eraser according to instructions (TaKaRa, Beijing, China). A 414 base pair (bp ...
-
bioRxiv - Neuroscience 2020Quote: ... and a portion (1 ng) of the RNA were subjected to reverse transcription (RT) with a SMARTer™ PCR cDNA Synthesis Kit (Clontech, Mountain View, CA). Then ...
-
bioRxiv - Cancer Biology 2021Quote: Reverse transcription and cDNA amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara Bio, Kusatsu, Shiga, Japan). The resulting amplified cDNA libraries were assessed for DNA concentration using the Qubit dsDNA HS Assay Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... Virus concentration was estimated by p24 titration using the FLAQ assay76 (HIVGKO and VLPs) or the Lenti-X™ p24 Rapid Titer Kit (Clontech; HIVNL4-3/Luciferase).
-
bioRxiv - Developmental Biology 2020Quote: ... Lentiviral supernatant titers were determined by Lenti-X p24 Rapid Titer Kit (supplemental Table 3) according to manufacturer’s protocol (Takara Bio USA, Inc. California, U.S.A).
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated using a template□switch anchored reverse□transcription polymerase chain reaction (RT□PCR) based on the SMARTer pico cDNA PCR Synthesis Kit (Clontech, Mountain View, CA, USA). The final cDNA product was then subjected to a clean□up step using PCR Clean DX Beads (Aline Biosciences ...
-
bioRxiv - Developmental Biology 2021Quote: PCR products were subcloned in frame with GFP sequence in 3′ into pCS2+-GFP vector using In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). For rescue experiments ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...