Labshake search
Citations for Takara Bio :
4551 - 4600 of 5597 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the pLVX-G9R+A1L-puromycin or pLVX-G9R+A1L-blasticidin plasmids were transfected into 293T cells using the Lenti-X Packaging Single Shots kit (631275, TaKaRa). Lentiviral supernatants were harvested 48 hours post-transfection and filtered through a 0.45 μm membrane (SLHV033RB ...
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries from input and IP samples were prepared using the SMARTer Pico Input Mammalian v2 RNA-seq kit (Takara) and sequenced as SE50 runs on an Illumina HiSeq4000.
-
bioRxiv - Molecular Biology 2024Quote: ... except that raw read processing by Cutadapt had to be adapted to different library construction method (SMARTer smRNA-Seq Kit, TAKARA). In particular ...
-
bioRxiv - Plant Biology 2024Quote: Rapid amplification of cDNA ends (5’ RACE) was used to determine the transcripts of the RB gene using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the protocol ...
-
bioRxiv - Neuroscience 2023Quote: RNAs were extracted from cultured cells and tissues using RNA extraction kit and reverse transcribed into cDNAs (both from TAKARA) according manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... Three nanograms of total RNA were used for amplification using the SMART-Seq V4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s recommendations (10 PCR cycles were performed) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Reporter plasmid libraries were made by cloning amplified ATAC fragments into AgeI-HF- and SalI-HF-linearized pSTARR-seq plasmid using InFusion HD cloning kit (Takara) and then propagated in MegaX DH10B T1R electrocompetent bacteria ...
-
bioRxiv - Developmental Biology 2024Quote: ... Library construction started from 4.9ng of RNA per sample made using the SMARTer Stranded Total RNA-seq Kit v3-Pico Input Mammalian (Takara; 634486). The quality of libraries was checked with the with the High Sensitivity DNA Reagents Kit (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 1 ng RNA was used as input to generate cDNA with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Digests were run on a 0.8% agarose-TAE gel and full-length plasmids were extracted with the Nucleospin PCR and Gel Cleanup Kit (Takara, 740609). A LR reaction was performed with 150 ng entry library and 150 ng pDEST_HC_Rec_Bxb_v2 ...
-
bioRxiv - Bioengineering 2024Quote: ... Appropriate colonies were grown and the recombinant bacmid DNA was extracted using the NucleoBond Xtra Midi plasmid purification kit (TAKARA). The fifth instar silkworm larvae ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA was quantified and 1.5 μg of RNA was used to prepare cDNA using PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio) and random hexamer primer ...
-
bioRxiv - Cell Biology 2024Quote: ... One to six nanograms of RNA were used to generate a cDNA library using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara). Samples were sequenced with a NextSeq 500 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The annealed fragment was ligated into NheI/EcoRI-digested pWALIUM20 (#1472, DGRC) vector using DNA Ligation Kit
(#6023, TaKaRa). -
bioRxiv - Microbiology 2023Quote: ... Reverse transcription reaction was set up using the cleaned-up RNA (1.6µg) using PrimeScript™ RT reagent Kit (Takara, Japan). The RT reaction was carried out with buffering temperature at 25 ºC for 2 mins ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... n = 3 pools of 250 GFP+ cells were collected for direct RNA-Seq library preparation using the SMART-Seq HT PLUS kit (Takara), according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral constructs pCMV-VSV-G and pCMV-dR8.2 dvpr 98 were transfected in HEK293T cells by the calcium-phosphate method (CalPhos Mammalian Transfection Kit, Takara, 631312) for virus production ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was extracted from PAMs using the TRIzol reagent and was reverse transcribed using the PrimeScript RT kit (TaKaRa). qPCR was performed using the PowerUp SYBR Green Master Mix on the ABI StepOnePlus system ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were ligated into pACT7_SC14 (HBB minigene reporter as previously described (31) using homology-based cloning technology (In-Fusion HD Cloning kit, Takara Bio). Following sequence verification ...
-
bioRxiv - Plant Biology 2023Quote: ... The tissue was fixed for 30 min and the immunoprecipitation performed using a SEP3-specific antibody followed by library preparation using ThruPLEX DNA-Seq Kit (Takara) and deep sequencing65 ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was then used for library preparation using the SMARTer small RNA (smRNA)-seq kit for Illumina (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... the promoter fragment was amplified and cloned between HindIII and XbaI sites using In-Fusion® HD Cloning Kit (Takara), generating pGWB502-HSP90.7pro ...
-
bioRxiv - Molecular Biology 2022Quote: ... was derived from foreskin-fibroblasts using the Stemgent mRNA Reprogramming Kit (Stemgent) as described previously (40) and maintained in a feeder-free culturing system Cellartis DEF-CS 500 (Takara). The inducible SpCas9 cell line was generated as described earlier (41).
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed using first-strand cDNA and a primer pair designed for target genes using the SYBR Premix Ex Taq Perfect Real Time Kit Tli RNAaseH Plus (TAKARA) and Thermal Cycler Dice Real Time System (Model TP800 ...
-
bioRxiv - Cell Biology 2023Quote: AAV plasmids were prepared by subcloning the ORF to pAAV-CAG-DNP63A7 or using the In-Fusion HD Cloning kit (Clontech).
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and was further reverse-transcribed into cDNA through the PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa). A LightCycler 480 II (Roche Applied Science ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicon was then cloned into the EcoRI and NotI recognition site of the expression plasmid pCAG neo using HD Cloning Kit (TaKaRa). To construct deletion mutants of bovine hnRNPM ...
-
bioRxiv - Microbiology 2023Quote: ... The resultant reaction mixture was then 10-fold diluted and subjected to quantitative PCR using TB Green Premix Ex Taq II kit (TaKaRa) in combination with a tag primer (no ...
-
bioRxiv - Cancer Biology 2023Quote: ... forward-Trail and reverse-Trail were generated in PZH vector amplified and extracted using In-Fusion HD Cloning kit (Clontech). Plasmids were sent for Sanger sequencing with reverse and forward primer to control any mutation point ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PrimeScript RT reagent kit with gDNA Eraser and TB Green® Premix Ex TaqTM were purchased from Takara (Otsu, Japan). Molecular Probes™ Dead Cell Apoptosis Kits with Annexin V for Flow Cytometry ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 7.4) and the protein contents of the cell lysate were quantified using a BCA Protein Assay Kit (TAKARA, T9300A) following the manufacturer’s protocol (Song et al. ...
-
bioRxiv - Immunology 2023Quote: ... covering SIV env and nef were amplified from plasma viral RNA by nested RT-PCR using Prime-Script one-step RT-PCR kit v2 (TaKaRa) and KOD-Plus v2 (Toyobo) ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of 5’ linker (10 μM) was ligated with 10 μl of Mighty mix (DNA Ligation Kit
, catalog num. 6023, Takara) to 4 μl of the sample coming from the previous step ... -
bioRxiv - Neuroscience 2023Quote: ... the RNA concentration was determined via Nanodrop and up to 100 ng was used as an input material for library preparation using the Clontech Ultra Low kit (Clontech).
-
bioRxiv - Immunology 2023Quote: ... RNA sequencing libraries were prepared by Edinburgh Genomics using a SMART-Seq® v4 PLUS RNA Kit (Takara Bio USA) with 9 cycles of amplification ...
-
bioRxiv - Genomics 2023Quote: ... 10 ng of total RNA were amplified and converted to cDNA using SMART-Seq v4 Ultra Low Input RNA kit (Clontech). Afterwards an average of 10 fmol of amplified cDNA was used to prepare library following SQK-PBK004 kit (PCR Barcoding kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted in between the KpnI and HindIII sites of the pOPINK vector (42) using the In-Fusion HD Cloning Kit (Takara). The pOPINK vector incorporates an N-terminal GST tag and a 3C protease cleavage site into the PhPINK1 construct ...
-
bioRxiv - Cancer Biology 2023Quote: ... the agarose gel pieces were cut out and digested using NucleoSpin® Gel and PCR Clean-Up kit (Takara, 740609), according to the manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2023Quote: ... The yeast two-hybrid library was generated from the poly(A)+ mRNA isolated from mixed-stage N2 nematodes using the Matchmaker kit (Clontech) as per the manufacturer’s protocol and transformed into Y1HGold strain (MATα ...
-
bioRxiv - Biochemistry 2023Quote: TssM193-490 coding region was obtained by gene synthesis (IDT) and cloned into pOPIN-K vector45 using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were introduced using the QuikChange Lightning kit (Agilent Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... The cDNAs were cloned into the pmCherryC1 vector using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized from 10 ng of total RNA using SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatants of infected cells were collected and infectious virus particles were measured using the Adeno X Rapid Titration Kit (Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were purified and ligated into the pMD-20 vector or the pANT vector using the Mighty TA- cloning Kit (Takara) or TA-Enhancer Cloning Kit (Nippon Gene ...