Labshake search
Citations for Takara Bio :
4401 - 4450 of 5597 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified DNAs were subcloned into the pCK-FLAG vector (CMV promoter-driven vector) at the BamHI and XhoI sites using In-Fusion HD Cloning Kit (Clontech). For dsRBD-deleted DICER ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The purification of the digested DNA and the ligation to the GenomeWalker adaptors were carried out according to the manufacturer’s instructions of the GenomeWalker Universal Kit (Clontech Laboratories). PCR reactions contained in a total volume of 50 µl 1x Long PCR buffer with MgCl2 ...
-
bioRxiv - Plant Biology 2019Quote: ... and oligodT primer were used for cDNA synthesis with PrimeScript RT Reagent Kit (Perfect Real Time) following the manufacturer’s instructions (Takara Bio). An amount of 5 μl of 25X dilute cDNA was used as a template for ddPCR reaction (total 20 μl ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 ng total RNA was reverse transcribed and full-length cDNA was specifically amplified by 8 PCR cycles using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech) (31) ...
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA was used to synthesize cDNA with a PrimeScript II 1st Strand cDNA Synthesis Kit (D6210A; TaKaRa, Dalian, China) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA was generated through a 3’-RACE-Ready cDNA synthesis reaction using the SMARTer RACE cDNA amplification kit (Clontech), following the user manual ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then further into the ClaI site of the avian replication-competent retrovirus vector RCASBP(B) (Li, Monckton, & Godbout, 2014) with the In-Fusion HD cloning kit (Clontech). The mutant construct that converts glutamine (Q ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was reverse transcribed to complementary DNA (cDNA) using a Prime Script™ RT Master Mix Kit (TaKaRa, China) and the following procedure ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR fragments containing M1 Spastin amino acids 197-328 was inserted into the C-terminus of FP-M11-92 linearized by BamHI enzyme using In-Fusion cloning kit (Takara). DsRed-M11-92-197-328 was constructed by replacing mApple in mApple-M11-92-197-328 with DsRed2 using NheI and EcoRI restriction sites ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed on 2 μg of total RNA using the Primescript Reverse Transcription Kit with a mixture of oligo-dT primers and random hexamers (Takara) after TURBO™ DNase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then each RNA sample (1 μg) was reverse transcribed using the Prime Script first-strand cDNA synthesis kit (catalog no. 6110A; TaKaRa). The internal control for qRT-PCR experiments was the 18S rRNA gene of BPH ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Forward (control) and reverse (target) RNA probes were synthesized from plasmids amplified via PCR (Advantage HD Polymerase Kit, Takara Bio) using T7 or SP6 RNA Polymerases (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNA was reverse transcribed into cDNA using SYBR® Premix DimerEraser™ (perfect Real Time) Kit (Takara, Shiga, Japan). Six pairs of specific primers were designed to amplify the genes selected from multiple comparisons (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Genetics 2020Quote: ... Microglial RNA was isolated using the TRIzol method and cDNA libraries were generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing Components (Takara) according to the manufacturer’s protocol.The libraries were sequenced as 150 bp paired-end reads with an average read depth of 42 million (range 16-98M ...
-
bioRxiv - Genetics 2020Quote: ... The guide for Cas9 was obtained by direct hybridization of the oligos and inserted in the same plasmid by Gibson assembly (In-Fusion HD cloning kit; Clontech) using the BtgZI sites.
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hours post-infection (hpi) using a CellAmp Direct RNA Prep Kit (3732; Takara, Japan) and culture medium collected at 24 hpi or 27 hpi was diluted 10-fold in water ...
-
bioRxiv - Genetics 2021Quote: ... Samples of 500 ng of RNA were reverse transcribed using PrimeScript™ RT Reagent Kit (Perfect Real Time) (TAKARA, RR037A). qPCR was performed using TB Green Premix Ex Taq reagent (TAKARA ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA with an OD value (A260/A280) of 1.8–2.0 was reversed transcribed to cDNA by using a PrimeScriptTM RT-PCR kit (Takara, Kusatsu, Japan). cDNA was amplified by Takara Taq™ (DR001AM ...
-
bioRxiv - Cell Biology 2021Quote: ... Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... All constructs were generated with two-insert seamless cloning (In-Fusion HD Cloning Plus Kit from Takara Bio, Cat# 638910) using NheI/BamHI linearized plasmid backbones (Addgene plasmid #54759 ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-RACE cDNA was obtained from bulk-sorted B cells of each animal with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The Ig PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Physiology 2021Quote: ... as well as the left and right homology arms were assembled and cloned into SmaI-digested pBluescriptII SK(-) in a single enzymatic reaction using the In-Fusion Cloning Kit (TAKARA). gRNA vectors were constructed in pDCC690 ...
-
bioRxiv - Plant Biology 2021Quote: Double-stranded RNA (dsRNA) of GFP and CHS were synthesized using the in vitro Transcription T7 Kit (Takara, Ohtsu, Japan). Briefly ...
-
bioRxiv - Genetics 2021Quote: ... Quantitative PCR was performed using KAPA SYBR Fast qPCR Kits (Nippon Genetics, Japan) on Dice Real Time System Single Thermal Cycler (Takara) or CFX96 Real- Time System (BioRad ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... a DNA fragment library of 220 bp insert size was prepared using the PrepX ILM 32i DNA Library Kit (Takara), and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA sample was diluted into 140 ng/μL and purified with the Primescript TM RT regent kit (Takara, RR047). cDNA was generated using SYBR® Premix Ex Taq™ II kit (Takara ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA synthesis from the total RNA was carried out using the PrimeScriptTM High Fidelity RT-PCR Kit (TaKaRa, Shiga, Japan) using an oligo dT primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... The specific PCR products were gel purified by using the DNA Gel Extraction Kit (Axygen, USA) and cloned to the pMD-18 vector system (Takara), and then sequenced by the Shanghai Sangon Company.
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA libraries were generated using Takara’s SMART-Seq v4 Low Input RNA Kit for Sequencing (Takara, Mountain View, California, USA) for cDNA synthesis and the Illumina NexteraXT DNA Library Preparation (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Libraries were simultaneously prepared using Takara’s SMARTer Stranded Total-RNA Pico v2 library preparation kit following manufacturer’s protocol (Takara cat#634412). Prepared libraries were sequenced on Illumina Nextseq500 at 2×75cycles.
-
bioRxiv - Pathology 2021Quote: ... First-strand complementary DNA was synthesized from total RNA using a PrimeScriptTM RT reagent kit with gDNA Eraser (Takara, China). Then ...
-
bioRxiv - Biochemistry 2021Quote: ... falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F (82) using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: The reverse-stranded total RNA-seq libraries (Fig. 4 and Fig. S2A) were prepared using the SMARTer-Seq Stranded kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2021Quote: ... 1 × 106 HEK293T cells were transfected with 4 μg donor and 2.5 μg pX330 Cas9 plasmid (CalPhos™ Mammalian Transfection kit, Clontech). After 72 h ...
-
bioRxiv - Cell Biology 2021Quote: ... One microgramme of total RNA was reverse-transcribed using a One Step PrimeScript™ RT-PCR Kit (Takara, Liaoning, China) with a thermocycler ...
-
bioRxiv - Cell Biology 2021Quote: ... The srpHemo promoter fragment was inserted at the Stu1 restriction site of the PCasper4 plasmid52 using the infusion kit from Clontech and the following infusion primer pair ...
-
bioRxiv - Genomics 2020Quote: ... We synthesized and amplified complementary DNA (cDNA) from each tissue using the SmartSeq v4 Ultra Low-input RNA kit (Clontech) from 1 ng of input RNA with 17 cycles of PCR ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Cancer Biology 2021Quote: ... by subcloning it into the multiple cloning site of the pKT2/CAGXSP vector19 through recombination cloning (In-Fusion HD Cloning Kit, Clontech). For the EV reporter ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... retroviral packaging construct pTG5349 and a reporter pCCLSIN.cPPT.hPGK.GFP.WPRE into HEK 293T cells by calcium-phosphate method (Calphos Mammalian Transfection kit, Clontech as per manufacturer’s instructions). Cells were seeded on 60×15mm dish a day before transfection to achieve 70 – 80% confluency ...
-
bioRxiv - Molecular Biology 2021Quote: Genes of interest were amplified from genomic DNA of W303-1A and cloned into the respective vector using the In-Fusion HD cloning kit (Clontech). Mutations and deletions were introduced by oligonucleotide-directed site-specific mutagenesis.
-
bioRxiv - Microbiology 2020Quote: ... All elements of the PbDCIII plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated into the SphI-SalI restriction sites of a pUC18 vector (In-Fusion HD Cloning Kit, Clontech). The resulting plasmid sequence was verified by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... All elements of the DiCre plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated (In-Fusion HD Cloning Kit, Clontech) into an acceptor plasmid containing a TgDHFR/TS cassette flanked by two LoxP sites ...
-
bioRxiv - Microbiology 2020Quote: ... The double-stranded oligonucleotides were end-labeled with [α-32P]-dCTP with the Random Primer Labeling Kit (Takara, Dalian, China). The binding reaction (28 μl ...