Labshake search
Citations for Takara Bio :
401 - 450 of 3966 citations for ssc mir 369 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... DNAse treated-RNA was reverse transcribed into cDNA using random hexamers and oligo (dT) primers with the Prime-Script RT Reagent Kit (Perfect Real Time from Takara Bio Inc., Otsu Shiga, Japan). Viral presence was assessed through RT-qPCR (StepOnePlus Real-Time ...
-
bioRxiv - Cell Biology 2021Quote: Point mutation primers were designed (Table S1) for PCR using 42B3-scFv as a template with Prime STAR (TaKaRa). KOD one PCR Master Mix Blue (Toyobo ...
-
bioRxiv - Cancer Biology 2021Quote: ... with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter; Takara Bio Inc.). pEGFP-C3 K19 WT ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Bioengineering 2024Quote: Primers oAS344 and oAS345 were then both used to amplify the cDNA using CloneAmp PCR Master Mix (Takara 639298) according to manufacturing protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... T-DNA insertions were then analysed using specific primers (Table S1) in PCR reactions with Emerald Master Mix (Takara). PCR conditions were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 3’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... followed by rDNase Set (Takara Bio, 740963) to digest DNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed on three biological replicates using an ABI StepOne PCR detection system with SYBR Green (Takara). GmUbiquitin (SUBI-2.2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). RNA isolated from 1000 cells was used as starting material ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). Single cells were used directly as starting material without RNA extraction to avoid extra loss of RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using a PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio, Shiga, Japan), purified using a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2022Quote: ... Forty ng cDNA was used as templates for RT-PCR using SYBR® Premix Ex Taq kit (TaKaRa, #RR820A) using LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments including the mutations inserted were obtained by RT-PCR using PrimeSTAR GXL DNA polymerase (Takara, cat# R050A) and the following primers ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative RT-PCR was used to determine gene expression using the SYBR Green Realtime Master Mix (Takara, DaLian, China). Table 1 contains a list of all primers used in this study ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was collected using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (TaKaRa, Cat# 3732) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was collected using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (TaKaRa, Cat# 3732). GAPDH and vRNA levels were measured with a RT-qPCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed using a Thermal Cycler Dice Real Time System II (Takara Bio Inc., Otsu, Japan) and SYBR Premix Ex Taq II (Takara ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ligated RNA was then subjected to TaqMan qPCR using the One Step PrimeScript RT-PCR Kit (Takara Bio), with 200 nM of a TaqMan probe targeting the boundary of the target RNA and the 3′-AD ...
-
bioRxiv - Cell Biology 2022Quote: ... and RT was performed using the PrimeScript RT Master Mix (TaKaRa). For the RT-qPCR analysis of miR ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed using PrimeScript™ RT Master Mix (Takara) and SYBR Green Premix Pro Taq HS (Takara) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Random Primer Mix (Takara) and 200 U SMARTScribe Reverse Transcriptase (Takara) ...
-
bioRxiv - Molecular Biology 2019Quote: ... miRNA was reverse transcribed using a Mir-X miRNA First-Strand Synthesis Kit (Clontech, USA) and the following procedure ...
-
bioRxiv - Microbiology 2020Quote: ... CTCF BS1 and CTCF BS2 were mutated by site-directed PCR mutagenesis using the primers detailed in Table 1 and Prime Star Max (Takara) mutagenesis kit following the manufacturer’s protocols and confirmed by sequencing ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genetics 2020Quote: ... Human CAD was PCR amplified from cDNA (Open Biosystems clone ID 5551082) using specific primers (Table S1) and ligated with In-Fusion (Clontech) into NotI linearized pcDNA3.1-GFP ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was conducted with tprK-specific primers (S1 Table) appended to 16bp PacBio barcodes using CloneAmp HiFi polymerase mix (Takara) and the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... gDNA extracted and PCR genotyped with primers (Supplemental table 1) flanking each homologous arms using PrimeStar GXL DNA polymerase (Takara). Correctly targeted clones were further expanded and banked ...
-
bioRxiv - Microbiology 2020Quote: ... The circularized DNA was subjected to PCR to generate a sequencing library using Illumina index primers and PrimeSTAR Max DNA polymerase (Takara). The PCR product was loaded and electrophoresed by 8% TBE PAGE ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).
-
bioRxiv - Microbiology 2022Quote: ... Seven Ns were added into the primers as the barcode for barcoded-subamplicon sequencing during the first round PCR (PrimeSTAR Max DNA Polymerase, Takara Bio ...
-
bioRxiv - Genetics 2022Quote: ... Reverse transcription was performed using the oligo(dT) primer and avian myeloblastosis virus reverse transcriptase contained in the TaKaRa RNA PCR kit (TaKaRa). RT-qPCR was performed using the Kapa SYBR FAST qPCR kit (Kapa Biosystems ...
-
bioRxiv - Genetics 2019Quote: ... The gene fragments of off-target sites were amplified with primers specific to each locus by 35 cycles of PCR with TaKaRa LA Taq (TaKaRa). The PCR products were purified and subjected to the process of denatured and annealed by using a thermocycler ...
-
bioRxiv - Molecular Biology 2019Quote: ... ERT2-3HA fragment was then PCR amplified using 2Fw and 2Rv primers and inserted between BmtI and BamHI sites of pmCherry-C1 (Clontech). The TBP coding sequence was PCR amplified from human cDNA and was cloned into SalI site of this plasmid containing ERT2-3HA ...
-
bioRxiv - Genetics 2021Quote: ... Reverse transcription was then performed using the oligo (dT) primer and Avian myeloblastosis virus reverse transcriptase contained in the TaKaRa RNA PCR kit (TaKaRa). We conducted RT-PCR using KOD One (TOYOBO ...
-
bioRxiv - Pathology 2021Quote: ... 5 µL of 1:10 diluted cDNA samples was used as the qRT-PCR template with 0.5 µM gene-specific primers and 10 µL SYBR Premix Ex Taq II (Takara, China) in a total volume of 20 µL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The cDNA samples were cloned into a pUC19 vector (PCR-amplified with primers 11 and 12) using In-Fusion HD Cloning Kit (Takara). After transformation into Escherichia coli ...
-
bioRxiv - Plant Biology 2022Quote: ... The genomic DNA sequences surrounding the potential off-target sites were amplified by PCR using specific primers (Supplemental Table S1) and PrimeSTAR GXL DNA Polymerase (Takara). PCR products were analyzed by sequencing.
-
bioRxiv - Plant Biology 2022Quote: ... the PCR products amplified by the primers spanning the introns were purified and cloned into pMD19-T vector (TaKaRa, D102A). About 10~20 clones of each PCR products were sequenced and aligned with the corresponding genes by SnapGene software.
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Neuroscience 2023Quote: Mammalian expression constructs were mainly generated by Gibson assembly of PCR-amplified coding sequences (primers, Supp. Data File 2) into restriction-digested pC1 (CMV promoter, modified from pEGFP-C1, Clontech) or pCAG (CMV enhancer fused to chicken beta-actin promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted in 50 mM NaCl at 100 ℃ for 30 min incubation followed by adjusting pH and PCR reaction using custom designed primers 23 and KOD Hot Start DNA Polymerase (Takara).
-
bioRxiv - Cancer Biology 2023Quote: ... Wildtype and mutant constructs were then PCR amplified using primers to encompass HA-EZH2 + add NotI and PacI for subcloning into pQXCIH (Clontech). See Supplemental Table 1 for the primer sequences ...