Labshake search
Citations for Takara Bio :
351 - 400 of 3750 citations for ssc mir 369 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: The coding sequence of AcGFP1 was amplified by PCR with the AcGFP_F and AcGFP_R primers and subcloned into the AgeI/NotI sites of pDsRed2-Mito (Clontech). The coding sequence of Venus (cDNA was obtained from Dr ...
-
bioRxiv - Genomics 2021Quote: ... primer pairs specific for each investigated enhancer were used for PCR amplification with the EpiTaq HS polymerase (TaKaRa). Finally ...
-
bioRxiv - Genetics 2020Quote: The final stitching PCR was performed using primers csrL-f and csrR-r with LA Taq polymerase (Takara) in a 50 μl reaction ...
-
bioRxiv - Genomics 2022Quote: ... Sublibraries were PCR amplified using primer-specific barcodes for each sublibraries and PrimeStar GXL DNA polymerase (Takara Bio) according to the manufacturer’s instructions in 50 µL reactions using 1µL of the total OLS library as template and 25 cycles of PCR ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR amplification was typically conducted with ~20 overlapping DNA base primers and the PrimeSTAR HS DNA Polymerase (Clontech) or the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Plant Biology 2023Quote: ... and AtMYB62 genes were amplified by PCR using gene specific primers and cloned into pGADT7-Rec vector (Takara). The recombinant constructs were transformed into Y1H gold strain (Takara) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Amp Primer (Takara), polymerase mix and nuclease-free water (95°C for 1 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... U6 primers (TAKARA) were used to normalize miRNA expression via the 2-ΔΔCq method (ΔCq = Cqtarget − Cqrereference).
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was amplified using PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, Shiga, Japan) under the following reaction conditions ...
-
bioRxiv - Molecular Biology 2022Quote: The RNA samples extracted from the fruit flesh were reverse transcribed using the PrimeScript RT-PCR Kit (TaKaRa) and the oligo(dt)20 primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNAs used for RT-PCR were synthesized using PrimeScript First-Strand cDNA Synthesis Kits (Takara, Osaka, Japan). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... and one μg RNA was converted to cDNA by using the PrimeScript™ RT-PCR Kit (Takara, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Cell Biology 2021Quote: RNA was quantified (by Nanodrop) and retrotranscribed to cDNA (PrimeScript™ RT-PCR Kit - Takara Bio Cat. # RR014A). Real time PCR was performed with KAPA SYBR® FAST qPCR Master Mix (2X ...
-
bioRxiv - Plant Biology 2021Quote: ... Synthesis of cDNA and quantitative PCR was conducted using the PrimeScript RT Master Mix (Takara Bio, Kusatsu, Japan) with Thermal Cycle Dice TP800 (Takara Bio) ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... Single stranded cDNA from the total RNA was synthesized with a RT-PCR kit (Clontech, Mountain View, CA) according to the kit’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time quantitative RT-PCR was performed with a PrimeScript II 1st strand cDNA Synthesis Kit (TaKaRa Bio) and SYBR Premix Ex Taq II (TaKaRa Bio) ...
-
bioRxiv - Plant Biology 2021Quote: ... HyPRP expression (in WT/ACD6-1HA) was analyzed by quantitative RT-PCR using SYBR Premix Ex Taq (Takara) in a Bio-Rad Real-Time CFX96TM C1000 system (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted RNA was reverse transcribed using a PrimeScript RT-PCR kit with DNase I (Perfect Real Time) (Takara) in accordance with the accompanying protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 1 µg was used for cDNA synthesis with the PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). Of the cDNA ...
-
bioRxiv - Immunology 2023Quote: ... Real-time quantitative RT-PCR (qPCR) reactions were performed with TB Green Premix Ex Taq™ (Takara, RR420A) in 384-well plates in a QuantStudio™ 6 Flex Real-Time PCR System ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was then performed on the cDNA using TB Green Premix Ex Taq II (RR820A, Takara), following the instructions manual.
-
bioRxiv - Developmental Biology 2023Quote: ... we confirmed successful repair by extracting mRNA and performing one step RT-PCR (Takara Primescript High Fidelity, RR057B). Primer sequences and design are detailed in Supplementary Fig 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... and then reverse transcribed into cDNA using MiR-X miRNA Synthesis kit (Clontech, USA) or SuperTranscriptase III (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... the corresponding miR-8 target sequence was inserted downstream of GFP in pAcGFP (Clontech) using the XhoI/NotI restriction enzyme site ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed with the MIR-X miRNA First Strand Synthesis from TAKARA following manufacturer’s specifications.
-
bioRxiv - Immunology 2022Quote: ... 0.5 µg of the isolated RNA was reverse transcribed to cDNA using an oligo dT primer and 12.5 units of reverse transcriptase mix (PrimeScript RT Reagent Kit, TaKaRa Bio, Saint-Germain-en-Laye, France). cDNA corresponding to 10 ng total RNA served as the template in a real-time PCR ...
-
bioRxiv - Biochemistry 2022Quote: ... one microgram of total RNA was employed to obtain the corresponding cDNA target sequences using an oligo(dT)18 primer and the PrimeScript RT reagent kit (Perfect Real Time, Takara Bio Inc., Otsu, Shiga, Japan), following the manufacturer’s directions ...
-
bioRxiv - Microbiology 2019Quote: ... 300 ng of each RNA was reverse transcribed to cDNA using random hexamers and oligo(dT) primers and following the instructions provided in the PrimeScript RT Reagent Kit (Perfect Real Time from Takara Bio Inc., Otsu Shiga, Japan). RT-qPCR was carried out in a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... DNAse treated-RNA was reverse transcribed into cDNA using random hexamers and oligo (dT) primers with the Prime-Script RT Reagent Kit (Perfect Real Time from Takara Bio Inc., Otsu Shiga, Japan). Viral presence was assessed through RT-qPCR (StepOnePlus Real-Time ...
-
bioRxiv - Cell Biology 2021Quote: Point mutation primers were designed (Table S1) for PCR using 42B3-scFv as a template with Prime STAR (TaKaRa). KOD one PCR Master Mix Blue (Toyobo ...
-
bioRxiv - Cancer Biology 2021Quote: ... with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter; Takara Bio Inc.). pEGFP-C3 K19 WT ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... T-DNA insertions were then analysed using specific primers (Table S1) in PCR reactions with Emerald Master Mix (Takara). PCR conditions were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Bioengineering 2024Quote: Primers oAS344 and oAS345 were then both used to amplify the cDNA using CloneAmp PCR Master Mix (Takara 639298) according to manufacturing protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 3’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... followed by rDNase Set (Takara Bio, 740963) to digest DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and RT was performed using the PrimeScript RT Master Mix (TaKaRa). For the RT-qPCR analysis of miR ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed using PrimeScript™ RT Master Mix (Takara) and SYBR Green Premix Pro Taq HS (Takara) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed on three biological replicates using an ABI StepOne PCR detection system with SYBR Green (Takara). GmUbiquitin (SUBI-2.2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). RNA isolated from 1000 cells was used as starting material ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). Single cells were used directly as starting material without RNA extraction to avoid extra loss of RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using a PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio, Shiga, Japan), purified using a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2022Quote: ... Forty ng cDNA was used as templates for RT-PCR using SYBR® Premix Ex Taq kit (TaKaRa, #RR820A) using LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments including the mutations inserted were obtained by RT-PCR using PrimeSTAR GXL DNA polymerase (Takara, cat# R050A) and the following primers ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...