Labshake search
Citations for Takara Bio :
401 - 450 of 684 citations for Tripartite Motif Containing 22 TRIM22 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... were mixed in a binding buffer (20 μL) containing 5 μL of 10×CutSmart® buffer and 1μL of RNase inhibitor (40U, Takara, Japan) and left for 10 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... The lentivirus or Vpx-VLPs containing media was harvested 72 h after transfection and concentrated 80 times using Lenti-X concentrator (Takara Clontech) or Lenti Concentrator (Origene) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cloned into into modified pJet:attB:mCherry vector (Roberts et al., 2014) containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Three days post transduction virus-containing supernatants were harvested and concentrated approximately 40-fold using Lenti-X Concentrator (Clontech; Mountainview, CA). Concentrated viruses were frozen and stored at −80°C until needed ...
-
bioRxiv - Neuroscience 2022Quote: ... The amplified linear PCR products containing the desired modification were ligated and transformed into Stellar™ Competent Cells (Takara Bio USA). All sequences were confirmed by DNA sequencing (UC Berkeley DNA Sequencing Facility).
-
bioRxiv - Neuroscience 2022Quote: ... and nucleus was removed from the pipette holder and contents were expelled into a PCR tube containing lysis buffer (Takara, 634894).
-
bioRxiv - Cell Biology 2023Quote: ... The media containing lentivirus were collected from transfected cells and were further concentrated by 50-fold using Lenti-X Concentrator (Takara, #631231). RAB12 KO A549 cells were infected with lentivirus expressing WT 3XFLAG-RAB12 or 3XFLAG-RAB12 S106A mutant ...
-
bioRxiv - Cell Biology 2023Quote: ... Single cells were sorted by FACS as described above into 96-well plates containing 0.1 μl of RNase inhibitor (Clontech, Cat# 2313A), 1.9 μl of 0.2% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus particles containing media were collected 24 h and 48 h after transfection and were concentrated using Lenti-X concentrator (Takara, 631232). The virus containing media was resuspended in Neurobasal media and tittered by puromycin selection using HEK 293T cell line ...
-
bioRxiv - Developmental Biology 2023Quote: ... The plate containing dried beads bound to single-cell DNA was extracted from the robot and processed following PicoPLEX® (Sopachem/Takara) protocol with half volumes as described in Macaulay et ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus-containing supernatant was harvested on days 2 and 3 after transfection and then concentrated using a Lenti-X concentrator (Clontech, 631232). HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentivirus was produced in DMEM containing 10% FBS and 1% BSA and then concentrated by the Lenti-X concentrator (Takara Bio).
-
bioRxiv - Neuroscience 2023Quote: ... 48-52 mCherry-positive cells from each mouse were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/µL; Takara Cat#ST0764). For retrograde transsynaptic tracing ...
-
bioRxiv - Neuroscience 2023Quote: ... we first produced a TRE3G-FlpO AAV carrying the optimised FlpO recombinase under the control of the third generation of tetracycline responsive element containing promoter (TRE3G, Clontech Laboratories). For this ...
-
bioRxiv - Synthetic Biology 2023Quote: ... T cells were incubated at 3×104 cells/well in 96-well U bottom plates for 24 hours in T cell media containing 50 IU/mL rhIL-2 and varying concentrations of AP20187 (B/B homodimerizer, Takara, 635058). After 24 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Each reaction was performed in a 25-μl volume containing 12.5 μl SYBR Premix Ex Taq (TaKaRa Biotechnology, Otsu, Shiga, Japan), 0.5 μl of forward and reverse primers (10 μM) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Only 0.5 µL of media containing cumulus cells from each mouse was added to 10 µL lysis buffer (Takara Bio Inc.). The oocytes were then treated with 1 mg/mL collagenase to remove the ZP ...
-
bioRxiv - Cell Biology 2024Quote: ... The TETon system was combined with a separate lentiviral compatible vector containing the reverse tetracycline-controlled transactivator Advance (rtTA Advance) (632162, Clontech, USA). Lentiviral particles corresponding to either TETon-BTN3A2 or rtTA Advance were generated using the above procedures ...
-
bioRxiv - Biophysics 2019Quote: ... Site-directed mutagenesis was achieved by polymerase chain reaction (PCR) of the full-length plasmid containing the Nav gene using PrimeSTAR® MAX DNA Polymerase (Takara Bio.). All clones were confirmed by DNA sequencing.
-
bioRxiv - Genomics 2021Quote: ... the synthesized cDNA products were subjected to real-time PCR in a reaction mixture (10 μl) containing Takara Premix Ex Taq (Probe qPCR) (TaKaRa, Kyoto, Japan), 200 nM hydrolysis probes and 200 nM PCR primers ...
-
bioRxiv - Neuroscience 2020Quote: ... The hippocampus was extracted and chopped into pieces using a razor blade then further homogenized using a 2ml douncer containing 2ml medium A with 80uL DNase (12500 units/mL) and 5ul recombinant RNase inhibitor (Takara Bio 2313B). Homogenized tissue was filtered through a 70um strainers to obtain a single cell suspension ...
-
bioRxiv - Neuroscience 2021Quote: ... The supernatant was removed and the cell pellet re-suspended with a 20 µL mix containing: 1X of the 5X PrimeSTAR GXL Buffer (Clontech, Takara Bio Europe), proteinase K (0.167 mg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Plant Biology 2021Quote: ... A 1 μg aliquot of RNA was used for the synthesis of the cDNA first strand using a PrimeScriptTMRT reagent Kit containing gDNA eraser (TaKaRa, Shiga, Japan). The cDNA was used as the template and primers in TableS1 were used to PCR amplify the sequence ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids for Env and associated mutants in addition to Gag were natively expressed from the reference HIV-1 clone NL4-3 with the following modifications: the pNL4-3 vector was sub-cloned into an SV40 ori-containing backbone (pN1 vector; Clontech; pSVNL4-3), deletion of pol by removal of the BclI-NsiI fragment ...
-
bioRxiv - Molecular Biology 2019Quote: The qRT-PCR analysis was conducted in a total volume of 20μL containing 10μl 2 × SYBR® Premix Ex TaqII (Tli RNaseH Plus) (Takara Bio Inc., China), combined with sense and antisense primers (0.8 μl ...
-
bioRxiv - Pathology 2021Quote: Some samples containing high viral RNA copy numbers were sent for viral sequence analysis by gene analysis services (Takara Bio, Shiga, Japan). The next generation sequencing (NGS ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Plant Biology 2023Quote: ... an aliquot (100 µL) of transformed cells was then plated onto SD media containing the appropriate dropout supplement (Takara Bio USA, Inc.), and grown at 30°C for up to 7 days.
-
bioRxiv - Plant Biology 2022Quote: ... The PCR fragment containing the SHHc tag was combined with the digested backbone using In-Fusion HD cloning (Clontech, Mountain View, California) to make pK7-SHHc ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR assays were performed in final volumes of 25 μl containing 12.5 μl of 2 × PCR Taq Mastermix (MgCl, dNTP, Taq enzyme) (Takara Bio Inc., Japan); 0.5μl of each primer (10 mmol/L) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Plant Biology 2023Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal and supplemented with 0.2 µg/ml Aureobasidin A (Takara Bio, USA). Plates were imaged after incubation for 60–72 hr at 30 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Fifty cells were collected in a tube containing ice-cold lysis buffer and processed for cDNA synthesis according to the Smart-Seq v4 manual (Takara Bio, 634890) with a PCR cycle number of 11 ...
-
bioRxiv - Cell Biology 2023Quote: The pCAG-MDM4 expression vector was established by cloning of MDM4 sequence into a pCAG vector47 containing a multiple cloning site (pCAG-MCS) using In-Fusion® Snap Assembly Starter Bundle kit (#638945; Takara Bio). A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Neuroscience 2024Quote: ... and individual cells were captured in separate wells of a 96-well plate containing 4 μl lysis buffer (1 U/μl RNase inhibitor [Clontech, Cat#: 2313B]), 0.1% Triton (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mouse monoclonal E-cadherin antibody (HECD-1) was purchased from Takara Bio Inc ...
-
bioRxiv - Genomics 2020Quote: ... and Living Colors DsRed Polyclonal Antibody (rabbit anti-E2-Crimson, Clontech [now Takara Bio USA] ...
-
bioRxiv - Genetics 2019Quote: ... GAL4 DNA-BD Mouse Monoclonal Antibody (Takara Bio USA, Inc. #630403), and GAPDH Mouse Monoclonal Antibody (CB1001-500UG 6C5 ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Cell Biology 2021Quote: ... JL-8 anti-GFP monoclonal antibody (TaKaRa, catalog # 632381, lot # A8034133) at 1:2,000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-CHS (sc-12620 ...
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Plant Biology 2021Quote: ... immunoblot with an anti-GFP antibody (1:5000 dilution, Takara Bio) followed by and detection were performed as described (Basu ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with primary antibodies: mouse anti-GFP (1:2000; Clontech), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by western blot using an anti-GFP antibody (632381, Clontech).
-
bioRxiv - Microbiology 2020Quote: ... Primary anti-6xHis monoclonal mouse antibody (Clontech, 631212, diluted 1:1,000) was used to detect 6xHis-ubiquitin in samples permeabilized with 0.5% Triton-X100 ...