Labshake search
Citations for Takara Bio :
301 - 350 of 684 citations for Tripartite Motif Containing 22 TRIM22 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... and blotted with anti-GFP/YFP antibody (mouse, Clontech) at 1:5000 dilution overnight at 4° C on a rocking platform ...
-
bioRxiv - Molecular Biology 2021Quote: Slide embedded tissue sections were incubated in PBS containing 0.2 mg/ml saponin (Nacalai teques) and 10 μg/ml Proteinase K (Takara Bio) for 20 min at RT ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 4 kb of the 3’ flanking region of MpBLD10 was inserted into the SmaI site of the pENTR/D-TOPO vector containing proMpBLD10 by using an In-Fusion HD cloning kit (Clontech). A silent mutation was introduced into the PAM site by inverse PCR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The CDS of monomeric Citrine was introduced into the SmaI site of the pENTR/D-TOPO vector containing the MpBLD10 genomic fragment by using an In-Fusion HD cloning kit (Clontech). The chimeric sequence was introduced into pMpGWB301 (Ishizaki et al ...
-
bioRxiv - Genomics 2019Quote: ... into individual wells of a 48-well plate (Brand) filled with 4 μl of a hypotonic lysis buffer containing 2 U/μL RNase inhibitor (Takara) and 0.2 % Triton-X-100 in Nuclease-free water ...
-
bioRxiv - Cell Biology 2019Quote: Expression plasmid for mouse FLAG tagged BAG3 (pFLAG-BAG3) was constructed by cloning partial mouse BAG3 cDNA containing the whole CDS into pEGFP-N1 (Clontech). Forward primer sequence used to clone BAG3 plasmid is 5′-AAAGGATCCAGCGCCGCCACCC-3′ and the reverse primer sequence is 5′-GACTCTAGATCACTAGGGAGCCACCAGGTTGC-3′ ...
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Neuroscience 2021Quote: ... cytosol and/or nucleus content in each pipette were expelled into individual PCR tubes containing 11.5 µl of lysis buffer (Takara, 634984) and stored in −80 °C.
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... U-[15N,12C,2H]-labelled REC3 domain was overexpressed in BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340) in M9 medium in 2H2O containing 2 g l−1 2H12C glucose (Sigma #552003 ...
-
bioRxiv - Physiology 2021Quote: ... Brain sections were then incubated overnight at room temperature in blocking solution containing primary antiserum (rat anti-mCherry, Life Technologies M11217, 1:1,000; rabbit anti-dsRed, Clontech 632496 ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were performed in a total volume of 20 μl containing 10 μl of TB Green Fast qPCR Mix (#RR430A, TAKARA), 0.4 μl of ROX reference dye II ...
-
bioRxiv - Plant Biology 2020Quote: ... and pC4H (2450bp) were cloned into a modified gateway vector containing an attL4 R1r cassette cut with XbaI using Infusion cloning (Takara). The expression constructs were transformed into Col-0 or mutant backgrounds using the floral dip method51 and selected using FastRed selection52.
-
bioRxiv - Plant Biology 2021Quote: ... containing a pBridge bait vector or diploid yeast strains generated by mating a Y2HGold strain containing a bait vector with a Y187 strain (Clontech) containing the pGADT7 vector ...
-
bioRxiv - Plant Biology 2021Quote: ... The EVD coding sequence (At5TE20395) was directly amplified from wt Col DNA using primers containing appropriate plasmid homology for In-Fusion Cloning (Clontech) into their respective digested binary vector backbones ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was further amplified by adding 40 μl of a PCR mix containing 0.03 U/μl of Terra PCR direct polymerase (Takara Bio), 1.25x Terra PCR Direct Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... The precipitated material was removed by centrifugation and the soluble fraction was loaded onto a column (5 mL) containing Talon affinity resin (Clontech) equilibrated in buffer A ...
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Biophysics 2022Quote: ... with insertion of N-terminal residues MATLEK a part of the N17 domain and C-terminal residues PQAQPLLPQPQPPPPPPPPPPGPAVAEEPLHRP which comprise the PR (proline-rich) domain containing the C38 domain using primers as a part of In-Fusion cloning protocol (Takara). eGFP-PolyQ31 was adapted from eGFP-PolyQ74 through the variability of Q-length PCR products amplified using CloneAmp HiFi PCR Premix (Takara) ...
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: ... N-terminal containing TAD and C-terminal containing bHLH of PIF4 were PCR-amplified and fused with GAL4 activation domain (AD) of the pray vector pGADT7 (Clontech). Bait and pray vectors were co-transformed in to the Y2H Gold yeast strain ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplifications were conducted in 50-μL total volumes containing 1 μL of template DNA using an ExTaq kit (Takara). The cycling protocol was as follows ...
-
X-ray mediated scintillation increases synaptic activity via Cerium-doped LSO and Channelrhodopsin-2bioRxiv - Neuroscience 2020Quote: ... 36-48 h post transfection lentivirus containing media was harvested and concentrated using Lenti-X concentrator (Takara, Mountain View, CA) as per manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for 11-13 cycles using 0.5 μL (2.5 U) LA Taq (Takara, Cat# RR002M) with P5-3’ and miRCat-PCR-2 oligos at an annealing temperature of 58°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Retrovirus supernatant or medium containing virus particles was harvested at day 2 post transfection and concentrated by Retro-Concentrator (Clontech) solution ...
-
bioRxiv - Cancer Biology 2019Quote: ... was excised and inserted in frame into a pcDNA3 vector containing fireflluciferase cDNA followed by a T2A sequence using the Infusion HD-eco dry kit (Clontech), as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... A 150-250 bp region encompassing each targeted locus was PCR amplified from ∼40 ng genomic DNA with ends containing partial Illumina adapter sequences using CloneAmp HiFi PCR (Takara). Reaction conditions were as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were incubated up to 48 hrs and then lentivirus-containing media was collected and concentrated with Lenti-X concentrator (Clontech). To transduce W4 cells in T25 flasks ...
-
bioRxiv - Immunology 2020Quote: ... The lentivirus or Vpx-VLPs containing media was harvested 72 h after transfection and concentrated 80 times using Lenti-X concentrator (Takara Clontech) or Lenti Concentrator (Origene) ...
-
bioRxiv - Cell Biology 2021Quote: ... a second fluorophore amplified by PCR and flanked by a SpeI and a SalI restriction site and containing a STOP codon was inserted into the SpeI/SalI restriction sites of a C1-vector backbone (Clontech). Additionally ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cloned into into modified pJet:attB:mCherry vector (Roberts et al., 2014) containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing CDS of each Hero protein and C-terminal FLAG and His tags was inserted into pCold I (Takara) by NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... The cell culture medium was replaced with pre-warmed DMEM containing 10% Tet system approved FBS (Tet-free medium, TaKaRa) and 30 μL of DNA-lipid complex was added to each well ...
-
bioRxiv - Cancer Biology 2022Quote: Telomerase-mediated extension and subsequent amplification of TRAP products were conducted in 25-µL reactions containing 1 µL of cell lysate and 2 U of Titanium Taq DNA polymerase (Takara). The other kit components—TRAP reaction buffer ...
-
bioRxiv - Immunology 2022Quote: ... Culture supernatants containing lentivirus were collected 24 and 48 h after transfection and concentrated by a Lenti-X concentrator (Takara) followed by passing through a 0.45-μm PES filter ...
-
bioRxiv - Neuroscience 2022Quote: ... the PCR fragments containing InDels were cloned into pL253 at the NotI and SpeI sites via InFusion cloning (Takara #ST0344). Bacterial recombinants were screened via PCR using primers 253.S (caaggcgattaagttgggtaac ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Bioengineering 2023Quote: ... with each 20 μl of PCR mixture containing 10 μl of TB Green Premix Ex Taq II (Tli RNase H Plus, Takara), 0.4 μl of each PCR forward and reverse primers (10 μM) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... each for a 50-µL reaction containing ∼30 fmol of EcoRI-XbaI digested pLVSIN-CMV-Pur backbone plasmid (Takara #6183), ∼300 fmol of the insert fragment ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total protein was lysed by homogenization in radioimmunoprecipitation (RIPA) buffer (FUJIFILM) containing protease inhibitor cocktail (NACALAI TESQUE) and Cryonase Cold-active Nuclease (TAKARA), while total RNA was extracted using an RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2023Quote: ... and was cloned into the AscI site of the pENTR/D-TOPO entry vector containing full length MpNEK1 CDS (Otani et al., 2018) by In-fusion system (Takara). The resulting vector pENTR/D-TOPO-MpNEK1-mCitrine was subjected to LR reaction to transfer MpNEK1-Citrine fusion into the Gateway binary vector pMpGWB144 (MpEF1α pro:XVE >>LexA operator:Gateway cassette).
-
bioRxiv - Cancer Biology 2023Quote: ... The construct containing Y181G-coding point mutation was generated by inverse PCR of Zdhhc20WT plasmid using CloneAmp HiFi PCR Premix (Takara) and joining the ends of the PCR product using InFusion cloning.
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Immunology 2023Quote: ... and GC B cells (live singlet CD19+ CD4− IgDlo CD71+CD38int CD20+ CXCR5+) were sorted using a FACSAria II into 96-well plates containing 2 μL Lysis Buffer (Clontech) supplemented with 1 U μl−1 RNase inhibitor (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted to 1 µg/mL with Milli-Q ultra-pure water for 5 min at room temperature or with a pollen germination medium containing 2000-fold SYBR Green I (Cat#: 5760A, Takara) and 5 µg/mL DAPI (Cat# 10236276001 ...
-
bioRxiv - Biochemistry 2023Quote: ... into which a PCR-amplified DNA fragment containing the mNeonGreen gene (Shaner et al., 2013) was inserted using the in-Fusion reaction (Clontech). To generate pRS426-CPY(1-50)-ATG15(Δ1-35)-mNeonGreen (YPL073) ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized with the PrimeScript 1st Strand kit with an additional primer mix containing random DTs (#RR047A and #6110A, Takara). cDNAs were amplified using specific Taqman probes ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...