Labshake search
Citations for Takara Bio :
401 - 450 of 939 citations for Tetanus Toxoid Recombinant Heavy Chain Fragment C since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Genomics 2021Quote: ... tissue or cells were placed in 2mL of EZ lysis buffer containing Recombinant RNase Inhibitor (Takara Bio 2313A), dounced 24 times with pestle A ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA was extracted using the hot phenol method and treated with recombinant DNase I (Takara, cat# 2270A) in the presence of RNasin Plus (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Immunology 2023Quote: ... 0.6% NP-40 and freshly added 1mM DTT) supplemented with 0.2U/µl recombinant RNase Inhibitor (Takara, Catalog # 2313B) and incubated for 5 minutes on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Biochemistry 2020Quote: ... were replaced by the BG505-NxT or BG505-NxS PCR fragments using the In-Fusion enzyme (Clontech) as described by the manufacturer ...
-
bioRxiv - Biochemistry 2021Quote: ... We ligated the two digested fragments together with the pLVX-EF1α-IRES-Puro vector (Takara Bio 631988) that was digested at XbaI and NotI restriction sites ...
-
bioRxiv - Plant Biology 2022Quote: ... Amplified fragments were inserted into the respective vectors by using the In-Fusion enzyme (Takara Bio, USA). For construction of CRISPR/cas9-mediated CLE42 knockout plants ...
-
bioRxiv - Microbiology 2022Quote: ... the fragments were sequentially ligated into the target vector using the In-Fusion HD Cloning Kit (Clontech). The resulting plasmid sequences were verified by Sanger sequencing (GATC Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... the respective fragments were excised with EcoRI and ligated into pCMV-Myc (Clontech Laboratories, Mountain View, CA). To generate the constructs coding for the double tagged Sun4 peptide sequences ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Microbiology 2019Quote: ... The two DNA fragments were then ligated with In-Fusion HD Cloning kit (TaKaRa Bio Inc., Japan) to generate pKLC5 ...
-
bioRxiv - Biochemistry 2019Quote: ... The amplified fragments were ligated using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA). pcDNA3.1(-)P-gp(MM ...
-
bioRxiv - Developmental Biology 2020Quote: ... The two DNA fragments were then ligated into one plasmid with the InFusion HD cloning kit (Takara).
-
bioRxiv - Developmental Biology 2022Quote: ... Genome fragments of each AQP gene were PCR-amplified using MightyAmp DNA polymerase ver.3 (Takara Bio) with the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were assembled into pEMC vector one-by-one using in-fusion HD cloning kit (Takara), generating pEMC-eGFP-MBaMV ...
-
bioRxiv - Molecular Biology 2023Quote: ... and fragments were cloned into the pSAM2-Puro lentiviral vector 13 by In-Fusion HD Cloning (Takara).
-
bioRxiv - Plant Biology 2023Quote: ... The DNA fragment was inserted into the cloning site of pColdIII expression vector (TaKaRa Bio, Shiga, Japan). The constructed vector and the chaperone co-expression plasmid pGro1254 were introduced into E ...
-
bioRxiv - Immunology 2023Quote: ... The fragments were gel purified and then assembled into a plasmid using in-fusion reagents (Takara Bio). The mCherry11-RNase L and mCherry1-10-RNase L were made similarly with oligos in Supplementary table 1 ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Neuroscience 2020Quote: ... each well of the lysis plates contained 0.4 μL lysis buffer [0.5 U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton X-100 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... lysed by sonication and the recombinant His-tagged protein purified from cell-free extracts using IMAC (Talon resin, Clontech) as previously described19.
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Microbiology 2019Quote: ... The Pfc43opt recombinant protein was soluble and purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant protein in the soluble fraction was then purified using TALON Metal Affinity Resin (Clontech Laboratories, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... the recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Cells were harvested three days after transfection and AAV2 was isolated using AAVpro Extraction Solution (Takara ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant adenovirus vaccines were produced using the Adeno-X™ Adenoviral System 3 according to the manufacturer’s manual (Takara Korea Biomedical Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Genomics 2023Quote: ... The recombinant pAAV-CRE plasmid was packaged in HEK293T cells using pHelper and pRC2-mi342 plasmids (Takara, Catalog #632608). Cells were harvested three days after transfection and AAV2 was isolated using AAVpro Extraction Solution (Takara ...
-
bioRxiv - Neuroscience 2024Quote: ... After the addition of 5 µl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) to the cap ...
-
bioRxiv - Cell Biology 2019Quote: ... 10 μM a/c heterodimerizer (Clontech, cat#635057) was added to the medium (the same volume of EtOH was added to the control group) ...
-
bioRxiv - Microbiology 2020Quote: ... then incubated with antibody against c-Myc (Clontech) in lysis buffer ...
-
bioRxiv - Genomics 2020Quote: ... 2013) with SalI and AgeI and subsequent insertion of fragments of interest by In-Fusion HD cloning (TaKaRa). Fragments of interest ...
-
bioRxiv - Biophysics 2022Quote: ... Resulting fragments were cloned into linearized FM5-mCh or FM5-GFP constructs using In-Fusion Cloning kit (Takara). The resulting plasmids were sequenced to confirm correct insertion.
-
bioRxiv - Biochemistry 2020Quote: The full-length L1 fragments of 15 high-risk HPV (hrHPV) were cloned in the pMD plasmid (Takara) to prepare HPV plasmids ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
bioRxiv - Cell Biology 2021Quote: ... The resulting DNA fragments/geneblocks were cloned using the Gibson assembly method into the pEGFP-N1 vector (Clontech) with the GFP removed by Sac1/Not1 digestion ...
-
bioRxiv - Cancer Biology 2020Quote: ... The mCherry-NTF2 fragment was excised from pDL23 at AgeI/BclII and cloned into pTetOne (#634303 Clontech, Takara) at AgeI/BamHI to generate pTetOne mCherry-NTF2 (pDL65) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The mCherry-NTF2 fragment was excised from pDL23 at AgeI/BclII and cloned into pTetOne (#634303 Clontech, Takara) at AgeI/BamHI to generate pTetOne mCherry-NTF2 (pDL65) ...
-
bioRxiv - Biochemistry 2020Quote: ... OLS subpools corresponding to a given gene fragment were PCR amplified using Primestar GXL DNA polymerase (Takara Bio) according to the manufacturer’s instructions in 50 µl reactions using 1 µl of the OLS pool as the template and 25 cycles of PCR ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR-amplified DNA fragments were assembled and cloned into pET-in situ Ble plasmid by recombination (InFusion, Clontech) and the resulting cell line was named ABbin situ ...
-
bioRxiv - Genetics 2019Quote: ... pENTR1A-OneSTrEP-Ash1FL was digested with BstZ17I and SphI and deltaSET_AB and deltaSET_CD fragments were introduced to the linear vector using InFusion (Clontech). pENTR1A-OneSTrEP-Ash1ΔSET plasmid was sequenced using ASH1_seq7 and ASH1_seq8 primers.
-
bioRxiv - Cell Biology 2019Quote: ... All lentiviral constructs were cloned using PCR amplification of complementary fragments and In-Fusion HD-based assembly (Takara). ErkKTR-BFP was cloned by PCR amplification of TagBFP (Addgene 102350 ...
-
bioRxiv - Evolutionary Biology 2021Quote: The gene fragments in the coding region of lg in zebrafish and tilapia were amplified using PrimerSTAR (Takara) (Table S7 ...
-
bioRxiv - Microbiology 2020Quote: ... The resultant fragments were inserted into the BamHI site in pAK405 by In-Fusion cloning (TaKaRa Bio, Inc.). These plasmids were independently introduced into SYK-6 cells and its mutants by triparental mating ...