Labshake search
Citations for Takara Bio :
401 - 450 of 5029 citations for Rat Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... LipofectamineTM 2000 kit and reverse transcription kit were purchased from TaKaRa Company ...
-
bioRxiv - Immunology 2024Quote: ... The RNeasy kit and the cDNA Synthesis Kit (Takara, Cat#: 9767, RR047A) was used to extract total RNA and prepare cDNA following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... 2,3,5-trimethyl-3-thiazoline (TMT) was added to the panel as an outgroup and purchased from Clontech Enterprices ...
-
bioRxiv - Cell Biology 2019Quote: ... by the LiAc method following the protocol in the MATCHMAKER GAL4 Two Hybrid System 3 manual (Clontech). The TDM protein self-interaction was used as positive controls (45) ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Genomics 2021Quote: ... The Chip was then centrifuged at 1200xg for 3 min into a collection tube (Takara Cat# 640048). To remove residual PCR primers and detergent ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2019Quote: ... 3 washes with NT3 and final elution with 25 μl of elution buffer (Clontech, Machery-Nagel 740609.250).
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Plant Biology 2020Quote: Yeast two-hybrid analysis was employed using the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio, Japan) as previously described (Umezawa et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was bound to 3 mL (=1.5 mL bed volume) Talon SuperFlow Metal Affinity Resin (TaKaRa) per protein preparation ...
-
bioRxiv - Molecular Biology 2022Quote: The yeast two hybrid assay was performed as indicated in MATCHMAKER GAL4 two-hybrid system 3 (Clontech). The protein coding regions of genes used in this study were amplified from Guy11 cDNA with primer pairs listed in Table 1.1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genome fragments of each AQP gene were PCR-amplified using MightyAmp DNA polymerase ver.3 (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were diluted to 25,000 cells/mL and dispensed into ICELL8 3’ DE chips (Takara Bio, CA) using an MSND device (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... Products with 3’-dA overhangs were cloned into T-Vector pMD19 (Simple) (Takara Bio Inc., Shiga, Japan) to use as a template for sequencing.
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: LATaq Kit (RR002B, TaKaRa) was used in nested PCR ...
-
Effects of Sanhuang plaster on expression of MyD88, TRAF6, MIP-1β and IL-23 in rats infected by MRSAbioRxiv - Molecular Biology 2022Quote: ... Real-time fluorescence quantitative PCR kit and reverse transcription kit(TaKaRa Co., Ltd.); MyD88 Anti-body TRAF6 Anti-body MIP-1β Anti-body and IL-23 Anti-body (GeneTexCo. ...
-
bioRxiv - Biophysics 2020Quote: ... using a cDNA synthesis kit (PrimeScript 1st strand cDNA Synthesis Kit, Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used for purification and titration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Systems Biology 2022Quote: ... The SMART-Seq Library Prep Kit and Unique Dual Index Kit (TaKaRa, cat# R400745) were used to generate barcoded template library for sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Calcium phosphate transfection kit (Takara) was used for transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3.0 kit (Takara Bio, Inc.) and cloned into the EcoRI/XhoI sites of the pET32a (+ ...
-
bioRxiv - Cell Biology 2021Quote: ... SYBR Green PCR kit (Takara) was applied to conduct RT-qPCR ...
-
bioRxiv - Genomics 2022Quote: ... Purification Kit Maxi (Takara, 6676) and quantified by the AAVpro Titration Kit (Takara ...
-
bioRxiv - Molecular Biology 2019Quote: ... In-Fusion Cloning Kit (Clontech) was used for in vitro assembly of plasmids ...