Labshake search
Citations for Takara Bio :
401 - 450 of 2552 citations for Ethyl 4 acetyl 1 cyclopropyl 2 5 dimethyl 1H pyrrole 3 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Biochemistry 2021Quote: ... After sonication and centrifugation (20 000 g, 1 h, 4 °C) the supernatant was mixed with Talon Metal Affinity Resin (Takara Bio USA, Inc.). After 1 hour incubation at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biophysics 2024Quote: ... for 35 min at 4°C and the supernatant was incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Purification Buffer and 10 column volumes of Purification Buffer with 10 mM imidazole before elution using Purification Buffer with 300 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... After co-cultivation, the organoids were collected and resuspended in 4% paraformaldehyde (PFA, Servicebio, China) at 4 [or RNAiso Plus (Takara, Japan) at −80□ for further analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Immunology 2024Quote: ... SMARTScribe reverse transcriptase (5 U/uL, Takara), Template-Switching Oligo (TSO ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2021Quote: γ2 mCherry and tethered GluA2 (flop isoform)::γ260 were subcloned into the doxycycline-inducible expression vector pBI-Tet (Clontech, #6152-1) using the restriction sites MluI/XbaI and MluI/NheI ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl sense and 1 μl anti-sense primers of 100 μM each were mixed with 2 μl 10X Taq polymerase PCR buffer (Takara, Japan) and 16 μl ultra-pure water to a final volume of 20 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1–2 µg) was reverse transcribed using random hexamers and the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa). RT-qPCR was performed using a StepOnePlus qPCR system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2024Quote: ... version 2 (Takara cat. no. 634411). After sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg/mL doxycycline (Clontech, 631311), 0.5 mM lysine ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Immunology 2024Quote: ... and RNAse inhibitor (4 units) (Takara Bio, London, UK). After each plate was filled ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 ml TALON cobalt resin slurry (Takara Bio Inc.) was added (1 ml/tube ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0). 500nM enzyme was added to start reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...