Labshake search
Citations for Takara Bio :
201 - 250 of 2552 citations for Ethyl 4 acetyl 1 cyclopropyl 2 5 dimethyl 1H pyrrole 3 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg RNase H-treated RNA was poly-A tailed with 2 U of poly(A) polymerase (Takara) for 1 hour at 37 ℃ ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-3-3τ and β-actin were designed and synthesized by Takara (Table 1). To run the real-time PCR reaction ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatants were harvested and mixed 1 to 3 with Lenti-X concentrator (Takara, 631232), cooled down to 4C for 30 minutes and spun down for 45 minutes at 4C.
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA isolated from each condition was converted into cDNA and processed through the SMARTer® 5’/3’ RACE Kit (Takara Bio) for 5’-RACE following manufacturer protocols ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA oligonucleotide adaptors were sequentially ligated to the 3’ and 5’ ends of small RNA by T4 RNA ligase (Takara, Dalian, China). cDNA synthesis was performed using oligo (dT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus-containing supernatant was harvested on days 2 and 3 after transfection and then concentrated using a Lenti-X concentrator (Clontech, 631232). HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... fixed for 1 h in 4% paraformaldehyde/PBS (TAKARA BIO INC. Cat#T900), and subjected to antibody labeling ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Molecular Biology 2020Quote: ... Confirmatory “1-to-1” pairwise assays for selected interactants were performed with the MatchMaker Two-Hybrid System 3 (Clontech Inc.)
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Immunology 2024Quote: ... containing 0.5 ml of a 1:1 solution of phosphate-buffered saline (PBS):FBS supplemented with ribonuclease inhibitor (1:100; Takara Bio). For some samples ...
-
bioRxiv - Pathology 2024Quote: ... ENTV-1 and ENTV-2 were amplified by PCR (Table 2) using the high-fidelity DNA polymerase “PrimeStar GXL” (Takara), with primers targeting exogenous β-retroviruses ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Neuroscience 2023Quote: ... the mouse monoclonal anti-GFP (Jl-8, Clontech; 1:500 overnight at 4°C) primary antibody was used ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed in a 10 µL reaction volume containing 5 µL of 2× SYBR Premix Ex Taq (RR420A, Takara), 1 µL of diluted cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech, 632381 or anti-GFP.2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...