Labshake search
Citations for Takara Bio :
401 - 450 of 5711 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: The quantified RNA was converted into copy DNA (cDNA) using Primescript™ 1st strand cDNA synthesis kit (TaKaRa, Japan). 1st Reaction Mixture was prepared by adding 8.0 µl of RNA (1.0μg/concentration adjusted to 125.0ng/µl) ...
-
bioRxiv - Plant Biology 2021Quote: ... and the resulting double-stranded fragments were subcloned at the BsaI site of the pMpGE_En03 vector (Sugano et al., 2018) using the DNA ligation kit Ver.2.1 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... PCR products of EgGLUT1-ss gene were recovered from Agarose Gel with Agarose Gel DNA Extraction Kit (Takara, Japan), and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara ...
-
bioRxiv - Cell Biology 2020Quote: ... GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and pBS2_Pericentrin C-ter_InsR: CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F ...
-
bioRxiv - Pathology 2021Quote: ... Complementary DNA was synthesized using the PrimeScript™ RT reagent Kit supplemented with a gDNA Eraser (TaKaRa, Dalian, China) and random primers ...
-
bioRxiv - Cell Biology 2020Quote: ... The complementary DNA (cDNA) was synthesis via reverse transcription reaction using a PrimeScript RT reagent kit (Takara, South Korea) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
bioRxiv - Plant Biology 2022Quote: ... The location of T-DNA in mt2 was confirmed by using the GenomeWalker kit (Clontech Laboratories, Mountain View, CA) following the manufacturer’s recommended protocols ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The gRNA was then ligated into BsaI linearized pKSE401 using DNA ligation Kit v.2.0 (TaKaRa, Kusatsu, Shiga, Japan).
-
bioRxiv - Neuroscience 2023Quote: TUNEL assays were performed to detect apoptotic cell death using Clonetech ApoAlert DNA Fragmentation kit (Takara, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was transcribed into full-length complementary DNA using a SMART-Seq v4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Genomic DNA of the cell pellets was extracted and purified using a Nucleospin Blood XL kit (Takara Bio, #740950.10). Guides were amplified and barcoded by PCR using NEB Next Ultra ii Q5 MM (M0544L ...
-
bioRxiv - Plant Biology 2024Quote: ... a genomic DNA walk was carried out using the Universal Genome Walker 2.0 Kit (Takara Bio Inc. Company, USA). Genomic DNA was isolated using DNeasy ® Plant Mini Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand complementary DNA (cDNA) was synthesized using a PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China). SYBR Premix ExTaqTM (TaKaRa ...
-
bioRxiv - Plant Biology 2024Quote: ... The CtBOT6 DNA fragment and the amplified vector were then merged using the In-Fusion HD Cloning Kit (TaKaRa). Ct4 transformed with the pBin-GFP-hph-CtBOT6 vector express CtBOT6 under the TrpC promoter control ...
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into fungal transformation vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... This was followed by ligation of the guide RNA to the ligation oligo using the DNA Ligation Kit (Takara). Subsequently ...
-
bioRxiv - Cell Biology 2022Quote: ... a DNA fragment was PCR-amplified from human genomic DNA using Tks Gflex DNA Polymerase (#R060A, Takara Bio) and the primers listed in Table S1 ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were harvested and purified using TALON His-Tag Purification protocol (Clontech Laboratories, Mountain View, CA.) The SUMO tag was cleaved by Ulp-1 as described above and the protein was further purified using ion-exchange chromatography (Bio-Rad ...
-
bioRxiv - Neuroscience 2019Quote: ... following 0.5 mM IPTG induction for 17h at 28 °C and purification by TALON chromatography (Clontech), essentially as described10 ...
-
bioRxiv - Plant Biology 2022Quote: ... protein solution was collected and subjected to purification using His60 Ni Superflow resin (TaKaRa, California, USA) to remove 6×His-SUMO tag from the protein preparations ...
-
bioRxiv - Plant Biology 2021Quote: ... according to the manufacturer’s instructions and in combination with Fruit-mate for RNA Purification solution (Takara Bio Europe SAS ...
-
bioRxiv - Genomics 2019Quote: ... DNA-baits were generated by PCR using human genomic DNA (Clontech) as a template ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA fragments were amplified using GXL Prime Star DNA polymerase (Takara) using cDNA libraries as templates ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries were generated using Takara’s SMART-Seq v4 Low Input RNA Kit for Sequencing (Takara, Mountain View, California, USA) for cDNA synthesis and the Illumina NexteraXT DNA Library Preparation (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... mtDNA copy number was determined by quantitative PCR with Human mitochondrial to nuclear DNA ratio kit (Takara Bio USA, 7246).
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... were reverse transcribed to complementary DNA (cDNA) using both oligo dT and random primers with PrimeScript RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... 500 ng of total RNA was reverse transcribed (complementary DNA (cDNA) was synthesized using PrimeScript™ RT-PCR Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid pJYB240 was generated from pJYB212 by exchanging the mEos2 open reading frame by a PCR-amplified mTurquoise2 DNA (Goedhart et al. 2012) using the InFusion kit (Clontech). The parBF-mTurquoise2 gene from pJYB240 was introduced into pJYB243 ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted from 200 μL of pseudovirus using the MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 (TaKaRa, Japan), and the extracted mRNA was used as a template for reverse transcription using M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... and inserted between SpeI and NotI restriction sites (pFastBac1-hCAP-D3-[3C]-StrepII) by using restriction enzymes and a DNA ligation kit (TaKaRa). To create the hCAP-H2 construct with an N-terminal StrepII-tag (pFastBac-StrepII-[3C]-hCAP-H2) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplifications were conducted in 50-μL total volumes containing 1 μL of template DNA using an ExTaq kit (Takara). The cycling protocol was as follows ...
-
bioRxiv - Plant Biology 2021Quote: Tagmented DNA was amplified directly from the beads via 6 cycles of PCR amplification using the PrimeSTAR GXL Polymerase kit (Takara) and dual indexed adapters (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara). The resulting constructs were fully sequenced to confirm the absence of unwanted substitutions.
-
bioRxiv - Biophysics 2021Quote: ... The resulting DNA fragments were gel-extracted and cloned individually into the pBADC3 plasmid using InFusion EcoDry cloning kit (TaKaRa). All genes were fused with a C-terminal StrepII-tag for affinity purification.
-
bioRxiv - Developmental Biology 2022Quote: ... Immunoprecipitated DNA and input control (pooled DNA that did not go through the IP step) were finally processed into sequencing libraries using PrepX DNA Library Kit (400075, Takara) and sequenced using the Illumina platform (NextSeq 500 ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 500 ng RNA was reverse transcribed into complementary DNA (cDNA) using a PrimeScript II 1st Strand cDNA Synthesis kit (TaKaRa) or a QuantiNova Reverse Transcript Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was extracted from E8.5 trunk tissue (two wild-type trunks and two Aldh1a2-/- trunks) and DNA sequencing libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara). Sequencing was performed on Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2019Quote: ... and then was used for generating the first strand complementary DNA (cDNA) as described in the protocol of the Takara PrimeScript RT reagent Kit with gDNA Eraser (Takara). Briefly ...
-
bioRxiv - Bioengineering 2020Quote: ... Ligation products with the correct size were purified by DNA agarose gel extraction using NucleoSpin Gel and PCR Clean-Up Kit (Takara, 740609.250 ...
-
bioRxiv - Plant Biology 2019Quote: ... EPFL2 promoter DNA was amplified by PCR from Col genomic DNA and inserted at the HindIII and SmaI sites of pPZP211/35S using the InFusion kit (Clontech) yielding the intermediate vector pPZP211/pEPFL2 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 5’ and 3’ cDNA ends were subsequently amplified by RACE PCR using the SMARTer RACE cDNA Amplification Kit and Advantage HF2 DNA polymerase (Clontech) with gene-specific primers derived from the initial RT-PCR product (Supplemental Information ...
-
bioRxiv - Plant Biology 2021Quote: ... was added to mitigate DNA contamination prior to first-strand cDNA synthesis with PrimeScript™ RT reagent kit (Takara Bio) from approximately 1 g total RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was reverse transcribed to complementary DNA (cDNA) using a Prime Script™ RT Master Mix Kit (TaKaRa, China) and the following procedure ...
-
bioRxiv - Molecular Biology 2019Quote: ... The specific PCR products were gel purified by using the DNA Gel Extraction Kit (Axygen, USA) and cloned to the pMD-18 vector system (Takara), and then sequenced by the Shanghai Sangon Company.
-
bioRxiv - Developmental Biology 2020Quote: ... DNA libraries were generated using Takara’s SMART-Seq v4 Low Input RNA Kit for Sequencing (Takara, Mountain View, California, USA) for cDNA synthesis and the Illumina NexteraXT DNA Library Preparation (Illumina ...