Labshake search
Citations for Takara Bio :
451 - 500 of 5711 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... First-strand complementary DNA was synthesized from total RNA using a PrimeScriptTM RT reagent kit with gDNA Eraser (Takara, China). Then ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Genomics 2020Quote: ... We synthesized and amplified complementary DNA (cDNA) from each tissue using the SmartSeq v4 Ultra Low-input RNA kit (Clontech) from 1 ng of input RNA with 17 cycles of PCR ...
-
bioRxiv - Molecular Biology 2021Quote: Genes of interest were amplified from genomic DNA of W303-1A and cloned into the respective vector using the In-Fusion HD cloning kit (Clontech). Mutations and deletions were introduced by oligonucleotide-directed site-specific mutagenesis.
-
bioRxiv - Microbiology 2020Quote: ... Removal of genomic DNA and synthesis of cDNA were performed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). The concentration of purified RNA was quantified on a Nanodrop ND-1000 spectophotometer (NanoDrop Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Neuroscience 2020Quote: ... And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara). The resulting constructs were fully sequenced to confirm the absence of unwanted substitutions.
-
bioRxiv - Immunology 2022Quote: ... All resulting RNA was used as an input for complementary DNA synthesis using the SMART-Seq v4 kit (Takara Bio) and 10 cycles of PCR amplification ...
-
bioRxiv - Genetics 2022Quote: ... total RNA extraction and separation of residual DNA contamination were excuted using Plant RNA Extraction Kit (TaKaRa MiniBEST, kyoto, Japan), and RNase-free DNase I (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ORF of zebrafish znf598 (ENSDARG00000014945) was amplified by RT-PCR and cloned into pCS2+ via XhoI/XbaI restriction sites using DNA Ligation Kit (TAKARA). To generate znf598 point mutation in ORF (znf598 C13/16A) ...
-
bioRxiv - Molecular Biology 2023Quote: ... wild-type ORF was amplified using point mutated primers and cloned into pCS2+ via XhoI/XbaI restriction sites using DNA Ligation Kit (TAKARA). The ORFs of zebrafish etf1b (ENSDARG00000043976 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The ORF of zebrafish rpl36 (ENSDARG00000100588) was amplified by RT-PCR and cloned into pCS2+ via EcoRI/XhoI restriction sites using DNA Ligation Kit (TAKARA). The ORF of zebrafish znf598 (ENSDARG00000014945 ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was acquired by using the Prime Script RT reagent kit with genomic DNA (gDNA) eraser (TaKaRa, Beijing, China). The SYBR Premix Ex Taq II kit (TaKaRa ...
-
bioRxiv - Neuroscience 2022Quote: ... the BamHI/BsrGI digested PCR product was ligated to the linearized backbone using the DNA Ligation Kit - Mighty Mix (TaKaRa) resulting pPB-ef1a-NLS-EGFP-T2A-puro.
-
bioRxiv - Molecular Biology 2022Quote: ... Detection relied on a 32P-labeled DNA probe specific for GFP sequence synthesized with a random priming labeling kit (Takara) followed by exposure to film and development as described (43).
-
bioRxiv - Plant Biology 2023Quote: ... The tissue was fixed for 30 min and the immunoprecipitation performed using a SEP3-specific antibody followed by library preparation using ThruPLEX DNA-Seq Kit (Takara) and deep sequencing65 ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of 5’ linker (10 μM) was ligated with 10 μl of Mighty mix (DNA Ligation Kit
, catalog num. 6023, Takara) to 4 μl of the sample coming from the previous step ... -
bioRxiv - Immunology 2023Quote: ... Complementary DNA was prepared using a SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech Laboratories, CA, USA). Libraries were prepared using a Nextera XT DNA Library Prep Kit (Illumine ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of six libraries were generated using the ThruPLEX DNA-seq 6S (12) kit (Takara Bio Europe, TOWN, France). The concentration of each sample pool was measured with Quant-iT PicoGreen dsDNA assay kit (Invitrogen Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... the RNA was reverse transcribed into complementary DNA by PrimeScript RT (reverse transcriptase) using a primeScript RT-PCR kit (Takara), and qPCR was performed with SYBR Green-Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... This (DNA-free) RNA was reverse transcribed into cDNA by using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). Quantitative PCR was performed using a LightCycler 480 (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment coding GFP was inserted at the 5’ side of SYP32 by In-Fusion HD Cloning Kit (Takara), and the whole sequence was recombined into pGWB1 by LR Clonase II ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was reverse transcribed into complementary DNA (cDNA) using PrimeScript™ RT Reagent Kit (Takara, RR047B). Amplification of cDNA product was performed using specific primers with the TB Green® Premix Ex Taq™ II (Takara ...
-
bioRxiv - Molecular Biology 2024Quote: ... the annealed oligos were ligated into the digested lentiCRISPRv2 backbone using the DNA ligation kit (Mighty Mix) (Takara, Cat# 6023). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Molecular Biology 2024Quote: ... The annealed fragment was ligated into NheI/EcoRI-digested pWALIUM20 (#1472, DGRC) vector using DNA Ligation Kit
(#6023, TaKaRa). -
bioRxiv - Microbiology 2021Quote: ... DNA fragments were amplified from the genomic DNA of RIB40 using PrimeSTAR® HS DNA Polymerase (TaKaRa, Otsu, Japan) and ligated with vectors using the In-Fusion® HD Cloning Kit (TaKaRa).
-
bioRxiv - Microbiology 2022Quote: ... PCR was carried out using Tks Gflex DNA Polymerase Low DNA (TaKaRa). The PCR cycling procedure was as follows ...
-
bioRxiv - Genetics 2022Quote: ... DNA samples were then amplified with PrimeSTAR GXL DNA Polymerase (Takara Bio) with PCR forward/reverse primers containing Illumina adapter sequences (Table S3 ...
-
bioRxiv - Synthetic Biology 2022Quote: Each DNA fragments were amplified using PrimeSTAR DNA polymerase (TaKaRa, Shiga, Japan) and subcloned into vectors using T4 DNA ligase (TakaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... 12.5 µL of Tks Gflex DNA polymerase Low DNA (cat. #R091A, Takara) and 12.2 µL of NFW} was added ...
-
bioRxiv - Immunology 2024Quote: ... The digested DNA was self-ligated using T4 DNA ligase (Takara, Japan). The ligated product was precipitated using 3M sodium acetate and 100% ethanol ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Biochemistry 2023Quote: ... TAKARA DNA polymerase (TAKARA) was used for PCR reactions ...
-
bioRxiv - Plant Biology 2019Quote: ... One microgram of DNA-free RNA was used to synthesize cDNA by using PrimeScriptTM RT Reagent Kit (TAKARA, Kusatsu, Shiga, Japan).
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Plant Biology 2019Quote: ... 2.5 kb of promoter sequences were isolated from genomic DNA and inserted upstream of the ß-glucoronidase gene of pCambia1301 vectors using the In-Fusion Cloning Recombinase kit (Clontech). The constructs were transformed into Agrobacterium tumefaciens strain GV3101 by electroporation ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA was then subjected to genomic DNA (gDNA) elimination and reverse-transcription according to PrimeScript™ RT reagent kit protocols (Takara). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: ... Purified insert DNA was cloned into the linearized modRNA plasmid (5MCS3)(K et al., 2018) using the In-Fusion Cloning Kit (Takara Bio). The DNA template for modRNA synthesis was PCR amplified from the successfully cloned 5MCS3 plasmid followed by PCR purification using DNA Clean & Concentrator-5 (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... and a library for whole-genome sequencing was prepared using the PrepX ILM DNA library kit (Takara Biosciences, Mountain View, CA) for the Apollo 324 next-generation sequencing (NGS ...
-
bioRxiv - Cell Biology 2020Quote: ... putative miR-31-5p binding sequences were deleted in the plasmid DNA using PrimeSTAR Mutagenesis Basal Kit (TaKaRa Bio, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Equal amounts of RNA samples (200 ng) were used to generate complementary DNA using a PrimeScript RT reagent kit (TaKaRa Bio) with oligo-dT and random primers ...
-
bioRxiv - Microbiology 2022Quote: ... All DNA fragments were cloned into the respective vectors using an In-Fusion HD cloning kit (Clontech, Mountain View, CA, USA). All constructs or primers used to construct the HEV reporter genomes in Supplementary Table 1 have been validated through Sanger sequencing and are available upon request.
-
bioRxiv - Microbiology 2019Quote: ... The bacterial RNA was reverse transcribed into complementary DNA (cDNA) using the PrimeScript RT reagent Kit (Perfect Real Time) (Takara: RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... A full-length cDNA library was constructed for each sample using the TeloPrime Full-Length cDNA Amplification Kit V1 (Lexogen) and amplified using PrimeSTAR GXL DNA Polymerase (Takara Bio) with 22 PCR cycles of 98 °C denaturation for 10 seconds ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing libraries of the two MNase treated samples and the input gDNAs were prepared with the PrepX™ DNA Library Kit (Takara). The libraries were used as a template to generate 50 bp paired end (PE ...
-
bioRxiv - Genetics 2019Quote: ... The total amount of DNA-free RNA obtained from each tissue was reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The cohesive ends of the linearized plasmid were blunt-ended and self-ligated using a DNA Blunting Kit (Code No. 6025, Takara Bio). The DNA Blunting Kit can smooth DNA with 3ʹ- or 5ʹ- protruding ends ...
-
bioRxiv - Microbiology 2020Quote: ... The obtained linearized plasmid was excised from the agarose gel and purified using a MiniBEST Agarose Gel DNA Extraction Kit (Takara Bio). The cohesive ends of the linearized plasmid were blunt-ended and self-ligated using a DNA Blunting Kit (Code No ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products to be used as DNA templates were cleaned using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio). In vitro transcription was performed using MAXIscript T7 Transcription Kit (Thermo Fischer Scientific ...