Labshake search
Citations for Takara Bio :
401 - 450 of 756 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... or SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA, Figure 5) according to the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... milk 5%) and incubated with a 2000-fold dilution of anti-GFP (JL8; Clontech), anti-RGA (Agrisera) ...
-
bioRxiv - Neuroscience 2021Quote: A floxed stop cassette (69) was inserted 5’ of the tTA2 coding sequence (Clontech) into the plasmid pcDNA3 (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were harvested 5 days post-transfection and passed over Cobalt-TALON resin (Takara) followed by size exclusion chromatography on Superdex 200 Increase 10/300 GL (GE Healthcare ...
-
bioRxiv - Biochemistry 2022Quote: ... A398P and T435P mutations (pDONR221-AR-AD-TAU-5) using KOD polymerase (Takara Bio) and the following primer pair.
-
bioRxiv - Microbiology 2023Quote: ... and 5 µl of the treated mix were used to transform competent bacteria (Takara, Stellar™ Competent Cells ...
-
bioRxiv - Plant Biology 2023Quote: ... The reaction medium contained 2 µL of 5× In-Fusion HD Enzyme Premix (Clontech); 1 µL of linearized pFL61[GFP] (∼100 ng) ...
-
bioRxiv - Microbiology 2022Quote: A DNA matrix (Supplementary Table 5) was prepared with CloneAmp HiFi PCR Premix (Takara) using primer pair 56/60 (Supplementary Table 4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS of effectors were cloned into pGBKT-7 vector (Clontech, USA, PT3248-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were single-cell sorted into 96-well low-bind PCR-plates [Eppendorf] containing 3 μl of lysis buffer (0.5 units/μl RNase inhibitor [Takara] ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Biochemistry 2020Quote: ... The final supernatant was supplemented with NaCl to 150 mM and incubated with 3 mL His60 resin (Takara Biosciences) for 30 min ...
-
bioRxiv - Cancer Biology 2020Quote: Libraries were prepared using 1ng of purified cDNA according to the ICELL8® 3’ DE instruction manual (Takara Bio) using the Nextera Primer P5 (ICELL8® 3’ DE Kit ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Bioengineering 2022Quote: About 130 ml of clarified cell suspension was combined with 3 mL of TALON® resin (Takara Bio 635503) previously equilibrated in lysis buffer and rocked at 4°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: The s2m sequence or control scrambled sequence of s2m (s2m_scr) was inserted into the 3’ UTR of GFP in H6P plasmid using In-Fusion Cloning kit (TaKaRa) and verified by sequencing ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant with the soluble His6-UppH was loaded on to a 3 ml TALON Metal Affinity Resin (Clontech) equilibrated in binding buffer (50 mM Na2HPO4 ...
-
bioRxiv - Microbiology 2022Quote: ... and the 3’ flanking region) and the linearized pHIS906 were fused using the In-Fusion enzyme (TAKARA, Shiga, Japan) to create the pHIS3-AWP1 plasmid ...
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... to OD600 0.2–0.3 with 2–3 mL fresh AYE +Fe +Cys containing 40 ng/mL anhydrous tetracycline (aTC, Clontech 631310). On the third day ...
-
bioRxiv - Genomics 2024Quote: ... Supernatant containing viral particles was harvested after 2 and 3 days and concentrated 100x using Lenti-X concentrator (Takara) following manufacturers instructions.
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... then imaged after overnight expression and ∼3 hour incubation with 500 nM A/C heterodimerizer linker drug (Takara, 635055) or 100% ethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant adenovirus vaccines were produced using the Adeno-X™ Adenoviral System 3 according to the manufacturer’s manual (Takara Korea Biomedical Inc. ...
-
bioRxiv - Biophysics 2024Quote: ... to reduce the detergent concentration and incubated for 3 h with 10 mL Talon metal affinity resin (Takara Biotech) pre-equilibrated with buffer S supplemented with 0.1% β-DDM and 0.02% CHS ...
-
bioRxiv - Immunology 2024Quote: ... sfGFP-3×P3-DsRed and homology arms were PCR-amplified using PrimeSTAR® Max DNA Polymerase (Takara Bio, R045). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HRT for attaching GFP at the 3’ end of pan-1 was made by PCR (Takara PrimeStar Max) from plasmid pPD95.75 (Addene #1494 ...
-
bioRxiv - Genomics 2020Quote: ... 5 × 104 cells were stored at −80 °C in STEM CELLBANKER® (Takara Bio Inc.) until use ...
-
bioRxiv - Plant Biology 2020Quote: The 5’ Digoxigenin labeled R-box and non-labeled oligonucleotides were synthesized (Takara, Dalian, China). The binding mixture contained nuclear extracts ...
-
bioRxiv - Biophysics 2022Quote: ... This was then loaded onto a column with 5 ml His60 Ni-Superflow Resin (Clontech) previously equilibrated in the lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were probed with γ32P 5’ end-labeled oligonucleotide (Table S3) in ExpressHyb solution (Clontech) and scanned after exposition with Typhoon FLA 9500 scanner (GE Healthcare).
-
bioRxiv - Molecular Biology 2020Quote: ... They were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Cla I sites 5′ to the BamH I site (Clontech, Mountain View, CA, USA).
-
bioRxiv - Immunology 2024Quote: ... QPCR was then performed with a reaction mixture consisting of 5 μL SYBR Green (Takara), 0.2 μL Rox ...
-
bioRxiv - Microbiology 2023Quote: ... Synthesized DNA was cloned into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was prelinearized with NotI-HF (New England Biolabs [NEB] ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and CCR6high and transduced with lentivirus particles at an MOI of 5 using retronectin (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.