Labshake search
Citations for Takara Bio :
501 - 550 of 756 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Full-length RNA-seq libraries from CM and skin macrophages were prepared from ∼3 ng of total RNA using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) followed by Nextera XT protocol (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DAPI stained nuclei were diluted to a concentration of 60,000 cell/mL in 1x PBS + 1% BSA + 1x Second Diluent + 0.2U SUPERase·In RNase Inhibitor and dispensed onto the ICELL8 3 ‘DE Chip (Takara Bio, Cat# 640143) using the ICELL8 MultiSample NanoDispenser ...
-
bioRxiv - Biophysics 2022Quote: ... and slowly shaken with all-trans-retinal (added to a final concentration of 25 μM) in the dark at room temperature for 3–4 h in the presence of 0.5 % of Westase (Takara Bio, Inc.) to digest the cell wall ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from tissues of 13-month-old wildtype C57BL/6J mice (n=3) using RNAiso Plus (Takara Bio). Complementary DNA (cDNA ...
-
bioRxiv - Genomics 2020Quote: ... was linearized from the 3’LTR to the RRE by PCR and both PCR products were fused using In-Fusion Cloning (Takara Bio) and transformed into One Shot Stbl3 Chemically Competent E.coli (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... These identical sequences were generated via PCR with primers that contain a 5’ end identical to an adjacent segment and a 3’ end that anneals to the gene-of-interest sequence using a 2x hot-start PCR master mix (Takara, #R405A). The primers for PCR reactions were listed in Table 2.
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Promoterless bicistronic vectors were generated by removing the SV40 promoter from the bicistronic vector pRUF and the pRUF vectors containing the putative IRES sequences by PCR amplification using divergent primers (Supplementary Table 3) and the CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Neuroscience 2023Quote: ... the SV40pA was replaced by the 3’UTR of msSOD2 (Kaltimbacher et al., 2006) amplified from mouse brain cDNA (Clontech 637301) using primers AA35 and AA36 and inserted into the XbaI and NotI sites ...
-
bioRxiv - Neuroscience 2023Quote: Artificially synthesized (G4C2)50 sequences flanked at the 5′ end with an EagI recognition site and at the 3′ end with a PspOMI recognition site were subcloned into T-vector pMD20 (Takara Bio). To generate a longer repeat size ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesis of cDNA with biotinylated 3’ adaptor ligation was performed using a Small RNA Cloning Kit (Takara Bio Inc., Kusatsu, Japan) as previously reported (20 ...
-
bioRxiv - Neuroscience 2022Quote: Jacob-LMO4 interaction was reconfirmed using fusion vectors (bait vector pGBKT7, prey vector pGADT7) using MATCHMAKER Two-Hybrid System 3 (Takara Bio Europe/Clontech, France). Co-transformed yeasts were assayed for growth on quadruple drop-out medium (SD/–Ade/–His/–Leu/–Trp ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe Reverse Transcriptase (Takara ClonTech #639538) as described92 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three RNA lysis aliquots of the LC6 sample were processed and library preparation completed on the 3 aliquots with SMART-Seq® HT Kit (Takara) and Illumina Nextera reagents for tagmentation ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by selection of transformants and testing of pair-wise interactions by growth complementation assays on nutrient selection media as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To compensate for auto-activation of some constructs ...
-
bioRxiv - Zoology 2023Quote: ... Primers were designed on each contig (Table S3) and RT-PCR was performed using a 3’ RACE CORE Set (Takara Bio).
-
bioRxiv - Microbiology 2022Quote: ... the 3′ terminus of each strand of dsRNA was ligated with PC3-T7loop oligo (Table S1) using T4 RNA ligase (TaKaRa, China) at 16 °C for 16 h ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus-containing supernatant was harvested on days 2 and 3 after transfection and then concentrated using a Lenti-X concentrator (Clontech, 631232). HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Affinity purification of Ypq1-3C-GFP-8xHis was done by incubating the supernatant with 3 mL TALON cobalt resin (635502; TaKaRa Bio) pre-equilibrated with Column buffer (20 mM HEPES-KOH (pH 7.2) ...
-
bioRxiv - Cell Biology 2024Quote: Arrayed slides were blocked in PBST containing 3% (w/v) powdered milk within an Atlas Glass Hybridisation Chamber (Clontech, CA, USA) then hybridised to 400µl fluorophore-tagged peptide for 1 hour ...
-
bioRxiv - Plant Biology 2024Quote: ... total RNA was extracted from leaves of 3-week-old Arabidopsis plants or 40-day-old rice plants using the Minibest plant RNA extraction kit (Takara, 9769) and three independent biological replicates were performed ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from leaves of 3-week-old Arabidopsis plants or 1-week-old rice seedlings with Minibest plant RNA extraction kit (Takara, 9769) and three independent biological replicates were performed ...
-
bioRxiv - Neuroscience 2024Quote: ... D9891)-inducible adenoviral constructs were generated for Halo-TRIM9 and UNC5C-pHmScarlet using the adeno-X™ system 3 (Takara Bio, 631180), using the detailed protocol outlined by (O’Shaughnessy et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... Transfected HEK293T cells were cultured for 3 more days and then AAV was collected using the AAVpro Purification Kit Midi (Takara, 6675) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were changed to fresh media the next day and viral media was collected on day 3 for concentration with Lenti-X concentrator (Takara 631232). Cells were transduced with 8μg/mL polybrene ...
-
bioRxiv - Genetics 2024Quote: ... plus MTP38 (5’ – CTG GAG TTC AGA CGT GTG CTC TTC CGA TCT CCA GAA GTC TTA ACT GAT GAT CGG C – 3’) with PrimeSTAR Max DNA Polymerase (Takara Bio) to amplify a portion of Rad51 with universal Illumina adaptor 5’ overhangs ...
-
bioRxiv - Cancer Biology 2022Quote: ... pre-cleared by centrifugation at 1000xg for 5 min and concentrated by 40X using Lenti-X (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PGCs and EGCs were lysed at room temperature for 5 minutes in lysis buffer (Takara Bio, #635013) containing RNAse inhibitors (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara) and cDNA synthesized with SuperScriptIII (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB] ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.