Labshake search
Citations for Takara Bio :
4201 - 4250 of 5321 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The titer of harvested lentivirus was established using the Lenti-X RT-qPCR Titration Kit (Takara Bio, Cat. no. 631235). A representative calibration plot and LV tittering of pAIO is added as Supplementary data S4.
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplified mTurbo and FLAG-cyp40 fragments were introduced into XbaI site of pUASp-K10-attB vector using In-Fusion HD Cloning Kit (Takara). To generate UASp-mTurbo-FLAG-cyp40deltaTPR ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then purified and resuspended with SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions for mRNA amplification using 5’ template switching polymerase chain reaction (PCR) ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting mutant BAC was electroporated into NEB 10-beta cells and purified using the Nucleobond BAC 100 kit (Takara).
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for RNA sequencing were prepared from 5 ng RNA/sample using the SMARTer Stranded Total RNA-Seq Kit v2 -Pico Input Mammalian (Takara) according to the manufacturer’s instructions using 12 PCR cycles for amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... The freshly extracted plasmids were transformed into yeast strain Y2H gold by using a yeast transformation kit (TaKaRa, Beijing, China) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... were subjected to RNA-seq library preparation using SMARTer Stranded Total RNA-Seq Kit – Pico Input Mammalian (Cat. No. 635005, TAKARA). All the libraries were analysed through a Bioanalyzer for quality control ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated from 200ng of RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio; Cat. No. RR047A) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... A CVB3 genome encoding a NanoLuc luciferase (NLuc) reporter was generated using the In-Fusion HD Cloning Kit (Takara, 638909). NanoLuc luciferase was cloned from the pLenti6.2-Nanoluc-ccdB ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara-Bio) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... as described previously.15 Alkaline phosphatase (ALP) staining was also performed for pluripotency characterization using TRACP & ALP double-stain Kit (Takara) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Transient transfection was performed with the use of HilyMax liposome transfection reagent (Dojindo Laboratories) or CalPhos Mammalian Transfection Kit (Clontech). Unless otherwise noted ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... the annealed oligos were ligated into the digested lentiCRISPRv2 backbone using the DNA ligation kit (Mighty Mix) (Takara, Cat# 6023). Afterward ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using RNApure FFPE Kit (CWBIO, Jiangsu, China) and then treated with DNase I (TaKaRa, Kyoto, Japan) to remove DNA contaminants ...
-
bioRxiv - Plant Biology 2024Quote: Rapid amplification of cDNA ends (5’ RACE) was used to determine the transcripts of the RB gene using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA was quantified and 1.5 μg of RNA was used to prepare cDNA using PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio) and random hexamer primer ...
-
bioRxiv - Bioengineering 2024Quote: ... Appropriate colonies were grown and the recombinant bacmid DNA was extracted using the NucleoBond Xtra Midi plasmid purification kit (TAKARA). The fifth instar silkworm larvae ...
-
bioRxiv - Cell Biology 2024Quote: ... One to six nanograms of RNA were used to generate a cDNA library using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara). Samples were sequenced with a NextSeq 500 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The annealed fragment was ligated into NheI/EcoRI-digested pWALIUM20 (#1472, DGRC) vector using DNA Ligation Kit
(#6023, TaKaRa). -
bioRxiv - Genomics 2023Quote: ... Digests were run on a 0.8% agarose-TAE gel and full-length plasmids were extracted with the Nucleospin PCR and Gel Cleanup Kit (Takara, 740609). A LR reaction was performed with 150 ng entry library and 150 ng pDEST_HC_Rec_Bxb_v2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A, Takara). Quantitative primers were designed based on the gene sequences by Sangon Biotech ...
-
bioRxiv - Immunology 2024Quote: RNA libraries of esophageal epithelial tissue biopsies and organoids were prepared using SMART-Seq HT Ultra Low Input RNA kit (Clontech) and NEBNext Ultra II RNA Library Prep Kit for Illumina ...
-
bioRxiv - Immunology 2024Quote: ... and quantified using bulk RNA-seq (Psomagen) after construction of Illumina sequencing libraries using the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara). Noise from low-expression transcripts was filtered ...
-
bioRxiv - Immunology 2024Quote: ... we ran our linearized plasmid backbone and 83 bp PCR products on a 1% agarose gel and recovered each using the Gel and PCR Clean-up Kit (Takara) per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... complete sequences of the three genomic segments of AV2 were obtained by 5ʹ- and 3ʹ-RACE with the SMARTer RACE cDNA amplification kit (Clontech) using infected Nicotiana occidentalis leaf material (DSMZ ...
-
bioRxiv - Neuroscience 2024Quote: ... and then the tip of the recording electrode was broken into the nested PCR reagent system (Prime ScriptTm RT reagent Kit with QDNA Eraser, Cat: RR0471, Takara), and a cDNA synthesis kit was used to synthesize cDNA following the manufacturer’s protocol (PrimeScriptm II1st Strand cDNA Synthesis Kit) ...
-
bioRxiv - Cell Biology 2024Quote: RNA sequencing libraries of rRNA-depleted nuclear RNA or polyA RNA were prepared with SMARTer Stranded Total RNA-Seq Kit v2 (Takara) according to the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2024Quote: ... and introduced into linearized (with KpnI) pCGEN (Motteram et al. 2011) using the In-Fusion HD Cloning Kit (Takara Bio). The resulting vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... Three nanograms of total RNA were used for amplification using the SMART-Seq V4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s recommendations (10 PCR cycles were performed) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Reporter plasmid libraries were made by cloning amplified ATAC fragments into AgeI-HF- and SalI-HF-linearized pSTARR-seq plasmid using InFusion HD cloning kit (Takara) and then propagated in MegaX DH10B T1R electrocompetent bacteria ...
-
bioRxiv - Developmental Biology 2024Quote: ... Library construction started from 4.9ng of RNA per sample made using the SMARTer Stranded Total RNA-seq Kit v3-Pico Input Mammalian (Takara; 634486). The quality of libraries was checked with the with the High Sensitivity DNA Reagents Kit (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 1 ng RNA was used as input to generate cDNA with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Microbiology 2023Quote: ... the pLVX-G9R+A1L-puromycin or pLVX-G9R+A1L-blasticidin plasmids were transfected into 293T cells using the Lenti-X Packaging Single Shots kit (631275, TaKaRa). Lentiviral supernatants were harvested 48 hours post-transfection and filtered through a 0.45 μm membrane (SLHV033RB ...
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Neuroscience 2023Quote: RNAs were extracted from cultured cells and tissues using RNA extraction kit and reverse transcribed into cDNAs (both from TAKARA) according manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... except that raw read processing by Cutadapt had to be adapted to different library construction method (SMARTer smRNA-Seq Kit, TAKARA). In particular ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... SEAP activity in supernatant (25 μL) was measured using the Great EscAPe SEAP Chemiluminescence Assay kit 2.0 (Clontech, Fremonet, CA). The GLuc activity in supernatant (20 μL ...
-
bioRxiv - Cell Biology 2023Quote: ... the transfer plasmid (pBABEpuro-based or pLZRS-IRES-ΔNGFR/GFP-based) and pCMV-VSV-G were co-transfected into GP2-293 packaging cells using CalPhos mammalian transfection kit (Takara/Clontech) according to manufacturer’s protocol ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... was digested with NheI and KpnI and the Lmx1a CDS and IRES-GFP fragments were inserted using the In-Fusion HD Cloning kit (Takara). Molecular biology kits used are listed in Table T4.
-
bioRxiv - Genetics 2023Quote: ChIP-seq libraries were prepared starting with ∼1000 picograms of ChIP or input DNA samples using the ThruPlex DNA-seq kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... First-strand cDNA was synthesized using 1.5 µg RNA and Prime Script™ RT reagent Kit with gDNA eraser (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatants were collected and mixed with Laemmli buffer after measuring the protein concentration using a TaKaRa BCA Protein Assay Kit (TaKaRa). Samples were subjected to SDS-polyacrylamide gel electrophoresis and electrotransferred onto polyvinylidene difluoride membranes ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Plant Biology 2023Quote: ... the promoter fragment was amplified and cloned between HindIII and XbaI sites using In-Fusion® HD Cloning Kit (Takara), generating pGWB502-HSP90.7pro ...