Labshake search
Citations for Takara Bio :
4001 - 4050 of 6263 citations for Triiodothyronine T3 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were then treated with 1 µM Shield1 (Takara Bio Cat#632189) 5 days post-BFP sort then harvested for flow cytometry and Western blot analysis 3 days post-Shield1 treatment ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was incubated with 1 μL of S1 nuclease (Takara, Okasa, Japan) for 4 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1 ml Lenti-X Concentrator (Takara Bio; Cat. No. 631231), mixed thoroughly ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µL of premix WST-1 cell proliferation assay (Takara Bio, Inc.) was added to each well and the plate was incubated for an additional 2 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ten ng of cDNA were mixed with 1 x ExTaq buffer (TAKARA), 2.5 mM of each dNTP 2 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... and a dilution 1:000 of the anti-DsRed antibody (Takara; 632496) for mCherry were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... residues 1–1235) were cloned into the mammalian overexpression vector pcDNA3.1 (Clontech) together with a green fluorescent protein and a twin strep-II-tag sequence for affinity purification at the C-terminus ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... IHC was conducted using rabbit primary antibody dsRed (1:500, #632496, Takara) to label TdT+ cells ...
-
bioRxiv - Plant Biology 2023Quote: ... 25 mM ATP and 1.0 U μL-1 RNase inhibitor (Takara Bio) at 22°C for 1 to 2 h ...
-
bioRxiv - Plant Biology 2023Quote: ... α-galactosidase units were calculated according to the protocol (Clontech, P3024-1).
-
bioRxiv - Cell Biology 2024Quote: ... or pEGFP Actin C374S or pEGFP N1 vector (Clontech Catalog #6085-1) and were selected in 5ug/ml Neomycin (Sigma Catalog #A1720 ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 1:200 dilution and mouse monoclonal anti-mCherry antibody (Takara, 632543) in a 1:400 dilution at 4°C on rocker ...
-
bioRxiv - Neuroscience 2024Quote: ... NPCs and STRpcs were treated with either AP21967 (1 nM) (Takara, 635055) or Rapamycin (1 nM ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies included rabbit anti-DsRed (Takara Bio, catalog #632496, 1:1000) and chicken anti-NeuN/FOX3 (EnCor ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were treated with premix WST-1 (Takara, Catalog number: MK400) to determine cell viability following manufacturer’s instructions and incubated at 37°C for 1 hour ...
-
bioRxiv - Biochemistry 2024Quote: ... Membrane was then incubated with 1:1000 mouse anti-His6 antibody (Clontech) for 15 mins ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-dsRed (cross-reacts with TdTomato, 1:1,000, Clontech, Cat#632496), mouse anti-FAT36,7 (1:200) ...
-
bioRxiv - Plant Biology 2020Quote: ... The first-strand cDNA was synthesized from genomic DNA-removed RNA by using PrimeScript™ RT reagent kit (TaKaRa). Next ...
-
bioRxiv - Immunology 2021Quote: ... 1ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... The mutated NLRP3-D303N and NLRP3-L353P were generated using the PrimeSTAR Mutagenesis Basal kit (Takara Bio, Shiga, Japan) (Aizawa et al. ...
-
bioRxiv - Immunology 2021Quote: ... The first-strand cDNA synthesis was performed with the Prime Script RT Master Mix kit (Takara Bio Europe, France). Quantitative real-time PCR was performed at 60°C using Takyon ROX SYBR MasterMix (Eurogentec ...
-
bioRxiv - Immunology 2021Quote: ... was used to for two-step qPCR assay after cDNA synthesis using PrimeScript® reverse transcriptase kit (Takara, Japan). Gene expression was normalized to the expression level of β-actin ...
-
bioRxiv - Microbiology 2021Quote: ... The entire fragment was then infused into a pCAGGS expression vector using an Infusion HD cloning kit (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... ssDNA was purified using the Nucleospin Gel and PCR Clean-up kit (Machery-Nagel, distributed by Takara Bio USA) with buffer NTC used as recommended by the manufacturer ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... while those with <15ng were prepared using the SMARTer® ThruPLEX® DNA-Seq Kit (Takara Bio Inc, Japan) in the sensi-lab at NHM Oslo (Table S1) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Complementary DNA libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (TAKARA Bio) and Nextera XT DNA Library Prep kit (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... a sequence region of 5,000 bp between SnaBI and AgeI restriction sites was amplified using the HiFi amplification kit (Clontech, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2022Quote: ... Equal volume RNAs were subjected to reverse transcription using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan). Distribution of mat mRNAs or mat-exon1 mRNAs in transfected cells was assessed using SBYR-Green (Takara ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 500 ng total RNA using a Prime Script RT Reagent Kit (Takara Bio, Otsu, Japan). qRT-PCR was performed using a StepOne Real-time PCR Instrument (Applied Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcription (RT) was performed using a PrimeScript® RT Reagent Kit with gDNA Eraser (RR047A, TaKaRa, Dalian, China) in a 20 μL reaction mixture containing 1 μg of total RNA from each individual sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Bioengineering 2022Quote: ... and TP–mAG were ligated into the open circular pET-29b(+) using the In-Fusion HD Cloning Kit (TaKaRa) to generate the recombinant protein expression vectors ...
-
Nulliparity affects the expression of a limited number of genes and pathways in Day 8 equine embryosbioRxiv - Developmental Biology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... https://www.addgene.org/112849/)10 between the EcoRI and SpeI restriction sites by multi-cassette assembly using the InFusion cloning kit (Takara Inc.). The correct sequence of the donor region was validated by Sanger sequencing.
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Plant Biology 2019Quote: The 5’ ends of the viral genomes sequences were determined or confirmed using the 5’ Rapid Amplification of cDNA Ends (RACE) strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA Sequencing libraries were prepared with SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). RNA isolated from 1000 cells was used as starting material ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). Single cells were used directly as starting material without RNA extraction to avoid extra loss of RNA ...
-
bioRxiv - Neuroscience 2019Quote: ... and CaMPARI was fused to synaptophysin using the In-Fusion® HD Cloning method and kit (Takara Bio USA) after amplifying variants of CaMPARI with PCR using custom primers with base pair overhangs homologous to the synaptophysin plasmid (3’ Primer [CGATAAGCTTTTATGAGCTCAGCCGACC] ...
-
bioRxiv - Biochemistry 2019Quote: ... The PCR product was inserted into the linearized pGL4.17[luc2/Neo] vector by In-Fusion reaction using In-Fusion HD Cloning Kit (Takara). The URAT1/SLC22A12 promoter + pGL4.17 plasmid was transformed into the E ...
-
bioRxiv - Molecular Biology 2021Quote: Input and immunoprecipitated DNA were used to prepare multiplexed libraries using the ThruPLEX® DNA-Seq Kit (Takara Bio) and DNA Unique Dual Index Kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... was collected from 1.0 μg of sheared DNA (median, 200 bp) using an EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA (30 ng) was used for synthesis of cDNA with PrimerScript RT reagent kit with gDNA eraser (TAKARA BIO). QPCR was performed with TB Green Premix Ex-taq II (TAKARA BIO) ...
-
bioRxiv - Genomics 2020Quote: ... 1ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA).
-
bioRxiv - Plant Biology 2020Quote: ... This was followed by a nested PCR and cloning of the products using the Mighty TA-cloning kit (TaKaRa). Twenty independent clones were randomly picked and sequenced.