Labshake search
Citations for Takara Bio :
351 - 400 of 447 citations for pEGFP C2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: Experiments were performed using PtK2 GFP-α-tubulin cells (stable line expressing human α-tubulin in pEGFP-C1, Clontech Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... pNFLS2,51,55,66A-myc and pNFLS2,55,57,66D-myc constructs and then cloned these sequences into the pEGFP-N3 vector (Clontech/Takara Bio) between the EcoR1 and BamH1 restriction sites of the multiple cloning site ...
-
bioRxiv - Neuroscience 2021Quote: ... GFP-Alix and its mutant forms (GFP-Alix R757E, GFP-AlixΔPGY) were obtained by subcloning the various cDNAs into a pEGFP-C1 vector (Clontech). DNA constructs used for the rescue experiments were prepared in two steps ...
-
bioRxiv - Biophysics 2021Quote: The EGFR-GFP plasmid was constructed using the cDNA of human EGFR (pNeoSRαII) provided by Akihiko Yoshimura (Keio University) and was inserted into the pEGFP-C1 vector (Clontech) with the same linker sequence suggested by Carter and Sorkin (Carter and Sorkin ...
-
bioRxiv - Cell Biology 2024Quote: ... two PCRs were performed using li-Strep_ss-SBP-EGFP-Ecadherin (a gift plasmid from F. Perez) (Boncompain et al., 2012) and pEGFP-C1 (Clontech) as templates and the following primer pairs (GAT GCA CCC GGG AGG CGC GCC ATG and CTC CTC GCC CTT GCT CAC ACC TGC AGG TGG TTC ACG ...
-
bioRxiv - Synthetic Biology 2023Quote: A 10 cm dish of HEK293T cells that had been transfected with the GFP expressing plasmid pEGFP-N1 (Clontech) was washed with PBS and lysed by sonication on ice in PBS supplemented with 0.2 % Triton X100 ...
-
bioRxiv - Molecular Biology 2024Quote: Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Arf1-EGFP and Arf1-mCherry plasmids were obtained by subcloning Arf1 (Wessels et al., 2006) into pEGFP-N3 (Clontech) and pmCherry-N1 (Clontech) ...
-
bioRxiv - Biophysics 2021Quote: The SNAP-eGFP fusion construct was created by amplifying the SNAP fragment from pIRES-PEX5-SNAP/eGFP-SKL with the primers KR011/KR012 and subcloning it into HindIII/BamHI digested peGFP-N1 (Clontech).
-
bioRxiv - Biophysics 2021Quote: The PEX5L-SNAP fusion construct was created by amplifying the SNAP fragment from pIRES-PEX5-SNAP/eGFP-SKL with the primers KR022/KR026 and subcloning it into SalI/NotI digested peGFP-N1 (Clontech).
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA encoding Lyn was obtained from RBL-2H3 cells and subcloned into the pTRE2hyg vector with the cDNA encoding FKBP2 and EGFP (derived from pEGFP-N2; Clontech) to produce Lyn-FKBP2-GFP (Lyn-FG) ...
-
bioRxiv - Cell Biology 2020Quote: ... The expression construct coding for eGFP-NLS was produced from pEGFP-N1 (Takara Bio USA, Inc., Mountain View, CA, USA) accordingly ...
-
bioRxiv - Cell Biology 2022Quote: ... EcoRI-BglII digestion product of pAc-GFPC1-Sec61β was ligated into pmCherry-C1 vector (made by substituting mCherry for EGFP in pEGFP-C1 (Clontech) by AgeI-XhoI digestion) ...
-
bioRxiv - Molecular Biology 2021Quote: ... UAS-dH1::GFP and UAS-dH1K27A::GFP stocks were prepared by inserting the corresponding ORFs (WT or carrying a K27A mutation generated by PCR) into pEGFP (Clontech) to generate fusion proteins and then the inserts were cloned into pUAST (details can be provided on request) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the coding sequence for Map2 was inserted into the backbone of pEGFP-Tub (BD Biosciences Clontech, Franklin Lakes, NJ, USA) with restriction enzymes XhoI and BamHI after amplification from pDONR223-MAP240 (forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Genes of target prokaryotic proteins were amplified by PCR from corresponding genomic DNA and inserted into the pEGFP-C1 vector (Clontech). Mutated genes of prokaryotic proteins were obtained by PCR site-specific mutagenesis ...
-
bioRxiv - Neuroscience 2021Quote: ... IGF1R-mEGFP was prepared by inserting the coding sequence of IGF1R (a gift from Dr. Inna Slutsky) into pEGFP-N1 (Clontech) containing the A206K monomeric mutation in EGFP and the CAG promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... pLL5.0-EGFP-HRasC20 was generated by insertion of EGFP-HRasC20 fragment which was amplified from pEGFP-F (#6074-1; Clontech) by PCR into pLL5.0 vector ...
-
bioRxiv - Immunology 2020Quote: ... The coding region of ADAR1 p150 was amplified by PCR and the resultant PCR product was inserted into a pEGFP-C1 vector (Clontech) using XhoI/BamHI restriction enzyme–recognition sites to generate the expression construct ...
-
bioRxiv - Neuroscience 2020Quote: We transiently co-transfected cDNA constructs of GluN1 and GluN2A into mammalian human embryonic kidney 293 (HEK293) with a separate pEGFP-Cl vector (Clontech) at a ratio of 4.5:4.5:1 (GluN1/GluN2A/EGFP ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Cell Biology 2020Quote: The homology-directed repair template was ordered as a double stranded DNA fragment (gBlock, IDT) and cloned using MluI sites into pEGFP-C1 (Clontech).
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... The complete sequence of CDK5RAP3 without the stop codon was excised from pCR-hCDK5RAP3 by NheI/SalI and ligated into pEGFP-N3 (Clontech), resulting in plasmid phCDK5RAP3-EGFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 million cells were electroporated with 5 µg of plasmids encoding tested lncRNAs or with of the pEGFP-N3 reporter vector (Clontech) as previously described 30 ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... The cloned inserts were released by PstI and KpnI digestion and cloned into the eukaryotic expression vector pEGFP-C1 (Clontech) using the above procedure but with kanamycin selection ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... human KIF24 fragments encoding residue 1-4383 was excised from pEGFP-C1-KIF24 (Kobayashi et al., 2011) and sub-cloned into pLVX-IRES-Puro (Clontech). KIF24/TS621-622AA (TS ...
-
bioRxiv - Developmental Biology 2021Quote: ... was constructed by inserting a gBlock encoding sfGFP followed by an SV40 polyA sequence and a FRT-flanked ampicillin cassette in place of EGFP in the pEGFP-C1 plasmid (Clontech). For kcne4 and ndufa4l2a BACs ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-GGC ATG GAC GAG CTG TAC AAG TCC AAT TTA CTG ACC GTA CAC-3’ and on pEGFP-C1 (Clontech) with primer ...
-
bioRxiv - Neuroscience 2021Quote: ... hALG-2 E47A-E114A cDNA was kindly provided by Masatoshi Maki (Shibata et al., 2004) and was subcloned into a pEGFP-C1 vector (Clontech) to obtain GFP-hALG-2 E47A-E114A (GFP-ALG-2ΔCa).
-
bioRxiv - Cancer Biology 2021Quote: ... were generated from pEGFP-C3 K19 WT using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). GFP and GFP-tagged K19 WT and mutantconstructs were cloned from pEGFP-C3 K19 constructs into pLenti CMV Hygro (plasmid #17484 ...
-
bioRxiv - Microbiology 2022Quote: ... gRNAs targeting the selected region of the CMV and bGH sequences (235-310 and 1917-2029, respectively in pEGFP-N3, Takara), were designed accordantly to each ROI (Table S3 and Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Microbiology 2020Quote: ... fused to GFP was generated by subcloning from pEPI-GFP-UL44425-433 (42, 43) into the pEGFP-C1 vector C-terminal to GFP (Clontech). Constructs to express full-length or truncated EBOV-VP24 protein fused to GFP or GFP-UL44NLS were generated by PCR amplification from pCAGGS-FLAG-VP24 (kindly provided by C ...
-
bioRxiv - Cell Biology 2021Quote: The GFP-Snx9 construct was generated by cloning the cDNA for Snx9 (Hicks et al., 2015) into the HindIII and EcoR1 sites of pEGFP-C3 (Clontech). The mammalian Trbo-GBP construct was generated by cloning a gene synthesize fragment containing two tandem copies of the GFP nanobody into the V5-TurboID-NES_pCDNA3 vector ...
-
bioRxiv - Microbiology 2020Quote: ... The product was digested with EcoRI and SalI and ligated into similarly digested pEGFP-C1 (Clontech Laboratories, Mountain View, CA). All plasmids constructed utilizing PCR were sequenced to ensure that no unintended mutations were introduced ...
-
bioRxiv - Developmental Biology 2021Quote: ... the distal region of blastemas was co-injected and electroporated with a reporter plasmid (pEGFP-N2 or pRFP-N2; Clontech) together with the Tig1 ...
-
bioRxiv - Neuroscience 2021Quote: ... together with the P2A (Donnelly et al., 2001) sequence ATNFSLLKQAGDVEENPGP into the modified pEGFP-C1 vector by replacing EGFP (Clontech).
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... The EGFP-nsP3 truncations and alanine substitution mutations were constructed by subcloning the corresponding nsP3-encoding PCR products into the vector pEGFP-C1 (Clontech) using XhoI-KpnI restriction sites.
-
bioRxiv - Neuroscience 2021Quote: ... The PGK promoter-puromycin resistance gene cassette in the vector was further replaced by the CMV-eGFP cassette from the pEGFP-C1 vector (Clontech). The sequence-verified plasmid was transfected into Lenti-X 293T cells (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... RNAi-resistant full length LIC1 and LIC2 and LIC1 truncations were generated by PCR and restriction digest cloning into pEGFP-C3 (Clontech) and used for rescue experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-T42EM was created by cloning T42EM (Ding et al., 2006) into the HindIII and BamHI sites of the pEGFP-C1 plasmid (6084-1, Clontech). To verify tau protein expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Entry clones for targeting and interaction assessment in mammalian cell culture lines were shuttled into the appropriate destination vectors including: pEGFP-N3 (Clontech), pmCherry-C1 (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... mArl15WT-GFP-pLVX-puro construct was prepared by subcloning the BglII and XbaI fragment of Arl15-GFP from pEGFP-N3 into BamHI and XbaI sites of pLVX-puro vector (Clontech), prepared in dam-dcm- E ...
-
bioRxiv - Neuroscience 2023Quote: Mammalian expression constructs were mainly generated by Gibson assembly of PCR-amplified coding sequences (primers, Supp. Data File 2) into restriction-digested pC1 (CMV promoter, modified from pEGFP-C1, Clontech) or pCAG (CMV enhancer fused to chicken beta-actin promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... approximately 20% confluent HEK293T cells seeded in 12-wells plates were transfected with 300ng ZNRF3 encoding plasmid and 50ng GFP expression plasmid (pEGFP-C1, Clontech) using Lipofectamine 2000 ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified DNA encoding the sequence for H2A was ligated in frame with the BglII and SalI restriction digest sites of pEGFP-C1 (Clontech). To construct the pEGFP-H2A.X expression plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... a double-stranded DNA fragment corresponding to the loxJT15+C290C+17:m7+FLAG+17:HT1+HA+17:HT2+MYC+17:N+V5 portion was synthesized (Integrated DNA Technologies) and inserted at the C-terminus of GFP within the pEGFP-C3 plasmid (Clontech) using a GenBuilder Cloning kit (GenScript) ...