Labshake search
Citations for Takara Bio :
351 - 400 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and one μg RNA was converted to cDNA by using the PrimeScript™ RT-PCR Kit (Takara, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Cell Biology 2021Quote: RNA was quantified (by Nanodrop) and retrotranscribed to cDNA (PrimeScript™ RT-PCR Kit - Takara Bio Cat. # RR014A). Real time PCR was performed with KAPA SYBR® FAST qPCR Master Mix (2X ...
-
bioRxiv - Plant Biology 2021Quote: ... Synthesis of cDNA and quantitative PCR was conducted using the PrimeScript RT Master Mix (Takara Bio, Kusatsu, Japan) with Thermal Cycle Dice TP800 (Takara Bio) ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... Single stranded cDNA from the total RNA was synthesized with a RT-PCR kit (Clontech, Mountain View, CA) according to the kit’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time quantitative RT-PCR was performed with a PrimeScript II 1st strand cDNA Synthesis Kit (TaKaRa Bio) and SYBR Premix Ex Taq II (TaKaRa Bio) ...
-
bioRxiv - Plant Biology 2021Quote: ... HyPRP expression (in WT/ACD6-1HA) was analyzed by quantitative RT-PCR using SYBR Premix Ex Taq (Takara) in a Bio-Rad Real-Time CFX96TM C1000 system (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted RNA was reverse transcribed using a PrimeScript RT-PCR kit with DNase I (Perfect Real Time) (Takara) in accordance with the accompanying protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 1 µg was used for cDNA synthesis with the PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). Of the cDNA ...
-
bioRxiv - Immunology 2023Quote: ... Real-time quantitative RT-PCR (qPCR) reactions were performed with TB Green Premix Ex Taq™ (Takara, RR420A) in 384-well plates in a QuantStudio™ 6 Flex Real-Time PCR System ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was then performed on the cDNA using TB Green Premix Ex Taq II (RR820A, Takara), following the instructions manual.
-
bioRxiv - Developmental Biology 2023Quote: ... we confirmed successful repair by extracting mRNA and performing one step RT-PCR (Takara Primescript High Fidelity, RR057B). Primer sequences and design are detailed in Supplementary Fig 1 ...
-
bioRxiv - Immunology 2022Quote: ... 0.5 µg of the isolated RNA was reverse transcribed to cDNA using an oligo dT primer and 12.5 units of reverse transcriptase mix (PrimeScript RT Reagent Kit, TaKaRa Bio, Saint-Germain-en-Laye, France). cDNA corresponding to 10 ng total RNA served as the template in a real-time PCR ...
-
bioRxiv - Biochemistry 2022Quote: ... one microgram of total RNA was employed to obtain the corresponding cDNA target sequences using an oligo(dT)18 primer and the PrimeScript RT reagent kit (Perfect Real Time, Takara Bio Inc., Otsu, Shiga, Japan), following the manufacturer’s directions ...
-
bioRxiv - Microbiology 2019Quote: ... 300 ng of each RNA was reverse transcribed to cDNA using random hexamers and oligo(dT) primers and following the instructions provided in the PrimeScript RT Reagent Kit (Perfect Real Time from Takara Bio Inc., Otsu Shiga, Japan). RT-qPCR was carried out in a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... DNAse treated-RNA was reverse transcribed into cDNA using random hexamers and oligo (dT) primers with the Prime-Script RT Reagent Kit (Perfect Real Time from Takara Bio Inc., Otsu Shiga, Japan). Viral presence was assessed through RT-qPCR (StepOnePlus Real-Time ...
-
bioRxiv - Cell Biology 2021Quote: Point mutation primers were designed (Table S1) for PCR using 42B3-scFv as a template with Prime STAR (TaKaRa). KOD one PCR Master Mix Blue (Toyobo ...
-
bioRxiv - Cancer Biology 2021Quote: ... with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter; Takara Bio Inc.). pEGFP-C3 K19 WT ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... T-DNA insertions were then analysed using specific primers (Table S1) in PCR reactions with Emerald Master Mix (Takara). PCR conditions were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Bioengineering 2024Quote: Primers oAS344 and oAS345 were then both used to amplify the cDNA using CloneAmp PCR Master Mix (Takara 639298) according to manufacturing protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 3’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... followed by rDNase Set (Takara Bio, 740963) to digest DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and RT was performed using the PrimeScript RT Master Mix (TaKaRa). For the RT-qPCR analysis of miR ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed using PrimeScript™ RT Master Mix (Takara) and SYBR Green Premix Pro Taq HS (Takara) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RT-qPCR was performed on three biological replicates using an ABI StepOne PCR detection system with SYBR Green (Takara). GmUbiquitin (SUBI-2.2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). RNA isolated from 1000 cells was used as starting material ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). Single cells were used directly as starting material without RNA extraction to avoid extra loss of RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using a PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio, Shiga, Japan), purified using a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Cancer Biology 2022Quote: ... Forty ng cDNA was used as templates for RT-PCR using SYBR® Premix Ex Taq kit (TaKaRa, #RR820A) using LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments including the mutations inserted were obtained by RT-PCR using PrimeSTAR GXL DNA polymerase (Takara, cat# R050A) and the following primers ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative RT-PCR was used to determine gene expression using the SYBR Green Realtime Master Mix (Takara, DaLian, China). Table 1 contains a list of all primers used in this study ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was collected using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (TaKaRa, Cat# 3732) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was collected using a CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (TaKaRa, Cat# 3732). GAPDH and vRNA levels were measured with a RT-qPCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed using a Thermal Cycler Dice Real Time System II (Takara Bio Inc., Otsu, Japan) and SYBR Premix Ex Taq II (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... Random Primer Mix (Takara) and 200 U SMARTScribe Reverse Transcriptase (Takara) ...
-
bioRxiv - Microbiology 2020Quote: ... CTCF BS1 and CTCF BS2 were mutated by site-directed PCR mutagenesis using the primers detailed in Table 1 and Prime Star Max (Takara) mutagenesis kit following the manufacturer’s protocols and confirmed by sequencing ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genetics 2020Quote: ... Human CAD was PCR amplified from cDNA (Open Biosystems clone ID 5551082) using specific primers (Table S1) and ligated with In-Fusion (Clontech) into NotI linearized pcDNA3.1-GFP ...
-
bioRxiv - Microbiology 2019Quote: ... PCR was conducted with tprK-specific primers (S1 Table) appended to 16bp PacBio barcodes using CloneAmp HiFi polymerase mix (Takara) and the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... gDNA extracted and PCR genotyped with primers (Supplemental table 1) flanking each homologous arms using PrimeStar GXL DNA polymerase (Takara). Correctly targeted clones were further expanded and banked ...
-
bioRxiv - Microbiology 2020Quote: ... The circularized DNA was subjected to PCR to generate a sequencing library using Illumina index primers and PrimeSTAR Max DNA polymerase (Takara). The PCR product was loaded and electrophoresed by 8% TBE PAGE ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).