Labshake search
Citations for Takara Bio :
351 - 400 of 1988 citations for Recombinant Zebrafish IL 1 beta Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Clover-(His)6-LactC2 was purified from the supernatant with 3mL of the TALON superflow metal affinity resin (Clontech, CA). The resin was washed with 5 mM imidazole in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were washed twice with Pulldown Buffer and ran on SDS-PAGE followed by western blotting (anti-His Clontech 631212).
-
bioRxiv - Plant Biology 2021Quote: ... Ten colonies picked up with a tooth pick were diluted in 1ml 0.9%NaCl and spotted onto SD/-Ade/-His/-Leu/-Trp medium (Clontech, 630428) with or without a-X-Gal (GoldBio ...
-
bioRxiv - Microbiology 2022Quote: ... One μg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... medium and 10-fold dilutions of these cultures were dropped on SD control (−2) and selective medium additionally lacking His (−3) (Clontech). Empty vectors were used as negative controls ...
-
bioRxiv - Physiology 2022Quote: ... and cDNA libraries were generated using SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio, Inc., Kusatsu, Japan). Libraries were high-output single-end sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was obtained by centrifugation of the cell lysate at 10,000 g for 30 minutes and applied into the His TALON™ gravity column (Clontech). The columns were washed to remove the non-target proteins ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting amplicons were cloned into pKTS786 (a pcDNA 3.1/V5-His based vector) that had been linearized with BstX1 with an In-Fusion HD cloning kit (Takara 638909) (76) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Concentrated protein was bound to 0.5–1 mL of His60 nickel or HisTalon cobalt resin (Takara Bio) for 0.5–1 hr at 4°C while rotating in a 10-mL Pierce disposable column (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Molecular Biology 2020Quote: Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each well of the 96-well plate contained 3µL lysis buffer (10U Recombinant RNase Inhibitor (Takara Bio), 0.2% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2021Quote: ... RLK7ECD was fused with MIK2TK and inserted into the pUC19 vector using in-fusion recombinant enzymes (Clontech). After digestion with KpnI and SalI ...
-
bioRxiv - Microbiology 2021Quote: ... All expression vectors used the recombinant DNA techniques used the In-Fusion HD enzyme (Clontech, Felicia, CA). A series of deletion mutants of eqkeap1 (eqKeap1-ΔNTR ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcriptase-containing pseudoviral particles and recombinant reverse transcriptase standard of known concentrations (TAKARA, Cat. No. RR047A) were 10-timed diluted with nuclease-free water (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: The plasmid constructs used as repair template for recombinant virus generation were generated using InFusion cloning (TaKaRa). The sequence references below are based on the HSV-1 KOS genome accession number JQ673480 (Macdonald et al 2012) ...
-
bioRxiv - Molecular Biology 2020Quote: ... To generate the light-inducible clustering constructs, the CRY2olig sequence (Taslimi et al., 2014a) was inserted with a c-terminal mCherry tag (Clontech) into pGEMHE to generate pGEMHE-CRY2olig-mCherry ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... and tandem repeat Sgo_R3-4 (aa 621– 789) were cloned downstream of a hexahistidine tag and 3C protease specific linker by the In-fusion method (Clontech; primer sequences listed in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... siRNA resistant WRN transgenes containing a C-terminal 3xFLAG tag (designated WRNr) were synthesized and inserted into the lentiviral pLVX-IRES-puro plasmid vector (ClonTech) at GenScript ...
-
bioRxiv - Cancer Biology 2021Quote: ... and HRas was purified via its 6His affinity tag using immobilized metal affinity chromatography (TALON® Metal affinity resin (Takara)) followed by elution using an imidazole step gradient ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Biochemistry 2023Quote: ... Tm1 FL for motility assays was cloned with a HisSUMO-SNAP-tag between SacI and HindIII sites of the pET11 vector by InFusion cloning (Takara). The SNAP-Tm1 1-335 truncation was made by site- directed mutagenesis of the SNAP-Tm1 FL plasmid using primers that inserted a stop codon after aa 335 as described above.
-
bioRxiv - Biochemistry 2023Quote: Khc FL for in vitro studies was cloned with a HisSUMO-SNAP-3C-tag into MCS1 between BamHI and HindIII sites of the pFastBacDual vector by InFusion cloning (Takara). The Khc mutant constructs used for in vitro studies were generated by site-directed mutagenesis of the Khc FL plasmid using primers that either inserted a stop codon after aa 910 (Khc910 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The H2afx coding sequence from Mus musculus was ordered from Eurofins and cloned into the pOZ-N-FH backbone adding the 1xHA tag at the N terminus using the in-fusion HD cloning kit (#12141, Takara). Full length wild type H2afx coding sequence was then mutagenized to obtain the desired S139A point mutation.
-
bioRxiv - Microbiology 2023Quote: ... and cloning it into the EcoRI and EcoRV sites of pcDNA-EGFP-P2A in frame with the tag sequence by using an In-Fusion® HD Cloning Kit according to the manufacturer’s instructions (Takara). pcDNA-hAPOBEC1 was constructed by cloning the XhoI-HindIII fragments of pUC57-APOBEC1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... G9 deletion mutants were generated by PCR amplification or overlap extension PCR and inserted in frame with the MYC tag into the pCS2-MT-NLS expressing vector using the In Fusion Protocol (ST0345, Takara). All constructs were confirmed by Sanger sequencing.
-
bioRxiv - Bioengineering 2024Quote: ... The purified PCR product was cloned with a C-terminus 6-His tag into pET22b vector via NdeI/XhoI using the In-Fusion HD Cloning kit following the manufacturer’s protocol (Takara Bio). The construct was transformed into chemically competent E ...
-
bioRxiv - Cell Biology 2024Quote: ... The cDNA for p53 WT or p53 QM was cloned together with the DNA sequence for an NH2-terminal FLAG tag into pRetroX-Tight-Pur (Clontech). Retroviruses with the vesicular stomatitis virus–G (VSV-G ...
-
bioRxiv - Molecular Biology 2024Quote: ... to replace the HA tag with a 3X-FLAG tag and then replaced the microhomology sequences for EXOSC3 or ZFC3H1 using In Fusion cloning (Takara). pCRIS-PITChv2-dTAG-BSD (BRD4 ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA-seq library was prepared using the SMARTer Stranded Total RNA Sample Prep kit - HI Mammalian (Takara Bio Inc, Shiga, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg of RNA was used for library preparation with the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... this was followed by a second screening using the SD quadruple dropout (Leu−, Trp−, Ade−, and His−) selective medium (Clontech Takara Bio). After the elimination of duplicates containing the same AD/library plasmid via yeast-colony PCR ...
-
bioRxiv - Molecular Biology 2024Quote: 900 ng of total RNA isolated from HUVEC was used as input for SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... suspensions of the transformants were spotted onto SD plates with dropout supplements: Leu/-Trp (cat #630417) or -Ade/-His/-Leu/-Trp (cat #630428) (Takara Bio). The strains used in this assay are listed in Table S1.
-
bioRxiv - Microbiology 2023Quote: ... the amplified fragment was incorporated into the Bam HI site of pHSG396 using the In-Fusion HD cloning kit (TAKARA, Japan), resulting in the generation of pHSG396-ptrA.
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants containing the His-tagged fluorescent biosensors were purified with TALON Metal Affinity Resins (Takara Bio USA, Inc., California, USA) according to the manufacturer’s procedure ...