Labshake search
Citations for Takara Bio :
351 - 400 of 895 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The viral load was measured by RT-qPCR using One-Step SYBR® Primescript™ RT-PCR kit II (Takara). CT values of serum samples were used to calculate serum viral titre according to regression equation built by RNA extracted from 10 µL of 102-106 pfu/mL of ZIKV (PRVABC59 or MP1751) ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-PCR was performed using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time; Takara, Japan) and Thermal Cycler Dice® Real Time System Lite (TP700 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral supernatants were collected 48 h post-transfection and concentrated by adding one volume of Lenti-X Concentrator (Takara Bio) to three volumes of lentivirus-containing supernatant and incubating at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Then RNA was reverse-transcribed and amplified using One Step PrimeScriptTM III RT-qPCR Mix kit (Takara Bio, Kyoto, Japan). Primers and probes ...
-
bioRxiv - Plant Biology 2022Quote: ... PtoATPE and PtoPSBB) were co-transformed into the Y1HGold yeast strain using the Matchmaker One-Hybrid Library Construction and Screening Kit (Clontech), respectively ...
-
bioRxiv - Microbiology 2022Quote: ... One μg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Immunology 2020Quote: ... Detection of the number of copies of extracted RNA was performed using the Real-Time One-Step RT-PCR reagent (Takara). The following was the reaction system ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RNA quantification was performed by RT-qPCR targeting the S gene of SARS-CoV-2 using One Step PrimeScript RT-PCR Kit (Takara) with the following SARS-CoV-2 specific primers and probes ...
-
bioRxiv - Microbiology 2020Quote: ... according to the manufacturer’s instructions and detected by RT-qPCR assays with a One-Step PrimeScript RT-PCR kit (Takara, Japan) using SARS-CoV-2-specific primers on an Applied Biosystems 7500 Real-time PCR System.
-
bioRxiv - Cell Biology 2021Quote: ... Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The concentrations of the host and the parasitic RNAs were measured by RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with sequence-specific primers (Supplementary text).
-
bioRxiv - Neuroscience 2022Quote: ... 2016) with the design enabling two guide cassettes to be inserted into one SaCas9 plasmid by In-Fusion cloning (Takara). Guide sequences were designed using the online CRISPOR design tool (Haeussler et al ...
-
bioRxiv - Molecular Biology 2022Quote: Y1H library screening was performed by using the Matchmaker Gold Yeast One-Hybrid Library and Screening kit (Clontech,CA, USA). The promoter fragments of CaPR1 were inserted in the pAbAi vectors ...
-
bioRxiv - Microbiology 2023Quote: ... and were quantified by real-time RT-PCR using One Step TB Green PrimeScript RT-PCR Kit II (Perfect Real Time) (TaKaRa) and QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... One microgram of total RNA was used as a template in reverse transcription reactions using 0.2 mM dNTP (TakaRa Bio), 1 U/μL ribonuclease inhibitor (porcine liver ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara-Bio) and the following primers ...
-
bioRxiv - Immunology 2023Quote: ... covering SIV env and nef were amplified from plasma viral RNA by nested RT-PCR using Prime-Script one-step RT-PCR kit v2 (TaKaRa) and KOD-Plus v2 (Toyobo) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RT-PCR was performed to detect sorcs2 mRNA in wt embryos using the Titanium One-Step RT-PCR kit (Clontech) with primers 5’-TTTTGCGCACCTGTACCCAGCTG-3’ and 5’-TAACGCGCTCCTGAAGCAGAGTC-3’ for detection of mRNA after injection of different amounts of sMO and 5’-TTTTGCGCACCTGTACCCAGCTGTGTT-3’ and 5’ TAACGCGCTCCTGAAGCAGAGTCCATT-3’ for the different developmental stages ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products of the exons were assembled into one full-length sequence using overlapping PCR (In-fusion cloning, Clontech) for each TAS1R and were then subcloned into the pEAK10 expression vector (Edge Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Microbiology 2019Quote: ... and then prehybridized in 5 mL ExpressHyb (ClonTech) for 1 hour at 65°C ...
-
bioRxiv - Genetics 2019Quote: ... containing 5 μL 2X SYBR master mix (Takara), 30ng genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U/µL Ex Taq polymerase (TaKaRa, Japan), 20 mg/mL BSA (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples with RIN values >8 were used for library preparation according to manufacturer’s instructions (SmartSeqv4 RNASeq kit, Clontech) or manual library preparation for Ampliseq analysis (Ion AmpliSeq Lib Kit Plus) ...
-
bioRxiv - Microbiology 2021Quote: ... H6-Gfp-FtsZ and FtsZ were mixed in a 1:1 ratio for a final concentration of 8 µM in assembly buffer with GMPCPP (0.2 mM) and resuspended Talon Cobalt beads (Takara) and added ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... The pLVSIN-EF1α-AcGFP-C1 vector (5.5 μg) was added to 7 μL Lentiviral Mix High Titer Packaging Mix (Takara Bio Inc., Otsu, Japan), 1500 μL serum-free DMEM ...
-
bioRxiv - Physiology 2024Quote: Flies treated with the same procedure as the lifespan assay were collected after 7-day EF/Sham exposure and homogenized in RNAiso reagent (Takara Bio, Shiga, Japan). Ten to twenty flies were homogenized in one tube ...
-
bioRxiv - Plant Biology 2020Quote: ... The yeast one-hybrid (Y1H) assay was conducted using the Matchmaker™ Gold Yeast One-Hybrid Library Screening System kit (Cat. no. 630491, Clontech).
-
bioRxiv - Plant Biology 2019Quote: ... One microgram of DNA-free RNA was used to synthesize cDNA by using PrimeScriptTM RT Reagent Kit (TAKARA, Kusatsu, Shiga, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... The recombinant constructs was transformed into Y1H gold strain and Y1H assay was performed using Matchmaker® Gold Yeast One-hybrid screening system (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa, Japan) with specific primers (Table S2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gene expression in the cDNA samples was measured by one-step qRT-PCR using a One Step PrimeScript RT-PCR Kit (Perfect Real Time) according to the manufacturer’s specifications (Takara, Dalian, China). Quantitative real-time PCR was performed on the CFX Connect Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biochemistry 2019Quote: ... the URAT1/SLC22A12 gene promoter region was amplified using KOD One PCR Master Mix (TOYOBO) or PrimeSTAR® Max DNA Polymerase (Takara) with the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...