Labshake search
Citations for Takara Bio :
551 - 600 of 895 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 units/μl of Takara Ex Taq™ (Takara Bio Inc.). Each multiplex PCR amplification was conducted as follows ...
-
bioRxiv - Microbiology 2021Quote: ... The vRNA was eluted with 5 U of DNase I (Takara Bio) at 37°C for 30 min in a DNase buffer (40 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA reverse transcription was performed with 5 × PrimerScript RT Master Mix (Takara). qPCR was performed using a CFX Connect™ Real-Time System (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... clarified supernatants were purified using a 5 ml Cobalt affinity column (Takara). HCoV-OC43 S was purified using a StrepTrap HP column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reaction conditions were as follows: 5 μL 10× PCR buffer (Takara Bio), 5 μL dNTPs (25 mM ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Genetics 2022Quote: ... the pEGFP-N1 vector was used (Clontech, PT3027-5; Mountain View, CA). Mutagenesis was done using the QuikChange II XL kit (Stratagene ...
-
bioRxiv - Plant Biology 2021Quote: ... Strands with a 5′ monophosphate were radiolabeled with T4 polynucleotide kinase (Takara) and [γ-32P]ATP ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... first-strand cDNA was synthesized with 5’ RACE CDE Primer A (Clontech) (5’-RACE-Ready cDNA samples) ...
-
bioRxiv - Microbiology 2023Quote: ... pGP (# 6161) and pDON-5 Neo DNA (# 3657) were purchased from Takara Bio Inc ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was introduced to measure the relative expression of RDase genes by using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (Takara Bio, Saint-Germain-en-Laye, Germany). Primers targeting RDase genes were designed using the NCBI primer design tool with the setting parameters ...
-
bioRxiv - Neuroscience 2023Quote: ... We obtained 20 ng/ul RNAs (total 10 ul eluted RNA from one microdissected cell body) that we used for RNAseq (Clontech SMART-Seq Ultra Low Input RNA kit) in Scripps Florida Genomics Core (Currently known as The Herbert Wertheim UF Scripps Institute for Biomedical Innovation & Technology) ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’RACE reaction was performed according to the kit manufacturer’s instructions (Clontech / Ozyme ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein samples were run on a 4-12% Bis-Tris gel (Novex) and Western blots were performed with the following antibodies: α-GFP (Clontech Living Colors 632381 (JL-8); RRID:AB_2313808 ...
-
bioRxiv - Genetics 2021Quote: The PCR reaction mixture contained 0.05 μl Ex Taq polymerase (5 U/μl, TAKARA), 1μl 10X Ex Taq Buffer (20 mM ...
-
bioRxiv - Microbiology 2019Quote: ... cells were transiently transfected with 5 µg of the pTRE3G-Luc control vector (Clontech) using Lipofectamine LTX (see above) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μL of Yeastmaker Carrier DNA (10 mg/mL, #630440, Takara Bio, Kusatsu, Japan), 1 μL of genome-editing plasmid (200–600 ng) ...
-
bioRxiv - Genomics 2020Quote: ... and 72°C for 5 s) on the PCR Thermal Cycler Dice (Takara Bio) using PrimeSTAR MAX DNA polymerase (Takara Bio) ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech, Mountain View, CA). For ZK2B10 gene-specific lineage analysis ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Biochemistry 2020Quote: ... Clarified supernatants were purified using a 5 mL Cobalt or Nickel affinity column (Takara). Purified protein was concentrated ...
-
bioRxiv - Cancer Biology 2020Quote: ... or SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA, Figure 5) according to the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... milk 5%) and incubated with a 2000-fold dilution of anti-GFP (JL8; Clontech), anti-RGA (Agrisera) ...