Labshake search
Citations for Takara Bio :
351 - 400 of 1150 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Laminin-511 E8 fragment (Takara Bio, #T303, 0.05 – 2 µg/ml) and Laminin-521 (Biolaminin ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was applied to 2 ml Talon Superflow resin (Clontech) pre-equilibrated with buffer A (20 mM Tris/HCl pH 7.5 ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... PCR amplification was done using Advantage HF 2 DNA polymerase (Takara) for 30 cycles according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: The GAL4-based Matchmaker yeast 2-hybrid system (Clontech Laboratories Inc.) was used for yeast-two-hybrid analysis ...
-
bioRxiv - Cancer Biology 2022Quote: U-2 OS Tet-On cells were purchased from Clontech (#630919). MDA-MB-453 cells were purchased from the American Type Culture Collection (ATCC ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Plant Biology 2021Quote: ... Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA) was used for the process of yeast transformation ...
-
bioRxiv - Biochemistry 2021Quote: ... the supernatant was nutated with 2 mL of TALON resin (Takara) for 45 min ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 2 ug Retronectin (TaKaRa Cat. no. T110A), 1 ug anti-mouse CD11a (LFA1) ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 1x Titanium Taq buffer and 2 μL Titanium Taq polymerase (Takara) were mixed in 50 µL total volume ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in Mesenchymal Stem Cell Growth Medium 2 (TaKaRa Bio) supplemented with penicillin/streptomycin/amphotericin B (Wako) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... which were carried out by Advantage® 2 Polymerase (Takara Bio). Final products were outsourced for Sanger sequencing (HyLabs ...
-
bioRxiv - Biophysics 2024Quote: ... the sample was applied to 2 ml Talon Superflow resin (Clontech) pre-equilibrated with buffer A ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... containing chilled (4°C) RNA lysis buffer (SMART-Seq HT lysis buffer, Takara Clontech, #634439). This contained the oligo-dT primer ...
-
bioRxiv - Immunology 2021Quote: ... containing chilled (4°C) RNA lysis buffer (SMART-Seq HT lysis buffer, Takara Clontech, #634439). This contained the oligo-dT primer ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Biochemistry 2024Quote: ... DNaseI-treated total RNA (4 µg) was reverse transcribed using Primescript reverse transcriptase (Takara Bio) and random hexamers (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were used to prepare RNA-Seq libraries using the SMART-Seq v.4 Kit (Clontech) as previously described42 ...
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... Yeast transformation was conducted with Yeast Transformation System 2 (Clontech NO.630439). All primers used were listed in supplementary Table 1.
-
bioRxiv - Microbiology 2020Quote: ... 2 µl of dNTP mix (TaKaRa, 2.5 mM concentration, 200 µM final), 0.125 µl of HotStart ExTaq (TaKaRa ...
-
bioRxiv - Biochemistry 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... before loading into a TALON® 2 ml Gravity Column (Takara 635606). Columns were washed one additional time before elution in a single step (150 mM Imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... a set of primer/probe E484A (SARS-CoV-2) (Takara, Cat# RC322A) was used ...
-
bioRxiv - Microbiology 2022Quote: ... 1µl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 30 cycles according to the manufacturer’s instructions (forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTP and 2 U/mL of recombinant RNase inhibitor (Clontech) then spun down and frozen at −80°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Immunology 2020Quote: ... Whole transcriptome amplification (WTA) was performed with Advantage 2 polymerase (Takara Bio). WTA reactions were monitored with qPCR to determine optimal cycle number ...
-
bioRxiv - Synthetic Biology 2021Quote: ... After 2 days of incubation on selective media (SC-URA/630314/CLONTECH) at 30°C ...