Labshake search
Citations for Takara Bio :
451 - 500 of 1150 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... cDNA molecules were amplified using the Advantage 2 PCR kit (639206, Takara Bio) with initial denaturation at 95 °C for 1 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and gene-specific primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR was carried out using 2× TB-Green premix (TaKaRa) on a LightCycler-480®II (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G, Clontech) or 2 μg of the pLenti-CMVtight-Hygro-DEST plasmid with each cDNA of interest ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and primers specific for each gene ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized by adding 2 μl of PrimeScriptTM RT reagent kit (TaKaRa) to 500μg of RNA samples in 8 μl of distilled water (DW ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was incubated for 2 hr with TALON metal affinity resin (Takara) pre-equilibrated with 50 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Genetics 2024Quote: ... and PCR was carried out using 2×Ex Taq Master Mix (TaKaRa CW0718). The PCR reaction was composed of 0.5 µg of template ...
-
bioRxiv - Genomics 2024Quote: ... 0.8 mM dNTP mix and 2 U Ex Taq polymerase (TaKaRa, Otsu, Japan). The thermal profile of the reaction started with initial stage 90 s at 94 °C which was followed by 30 cycles of 45 s denaturation at 94 °C ...
-
bioRxiv - Genomics 2024Quote: ... 1x Ex Taq buffer and 2 U Ex Taq polymerase (TaKaRa, Otsu, Japan). The thermal profile started with initial stage 94 °C for 3 min which was followed by 30 cycles of 1 min denaturation at 94 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cDNA library was prepared using an Advantage 2 PCR Kit (Clontech, 639206) and then sequenced via the Illumina sequencing platform (NovaSeq 6000) ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat monoclonal anti-E-cadherin antibody (ECCD-2) (1:200) (Takara, Cat# M108), mouse monoclonal anti-Yap1 antibody (MO1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 ng of firefly luciferase (pGL) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 140 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The extract was incubated for 1 h at 4 °C with Talon resin (Clontech, Mountain View, CA), loaded onto a column ...
-
bioRxiv - Immunology 2023Quote: ... RNA was then amplified using SMART-Seq v.4 Ultra Low Input RNA kit (Clontech, cat. 63488). Subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
bioRxiv - Neuroscience 2020Quote: ... TetO/NGN2 gene expression was induced by Doxycycline (2 μg/mL; Clontech, Madison, WI) on day 0 ...
-
bioRxiv - Immunology 2022Quote: ... 2 μl of the pre-RT-PCR2 (PrimeScript™ II Reverse Transcriptase, Takara Bio) mix was added to each well ...
-
bioRxiv - Plant Biology 2021Quote: ... The Yeastmaker Yeast Transformation System 2 was used according to the manufacturer’s instructions (Clontech). pGBK-53 and pGADT were used as positive controls ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was produced from 2 mg overall RNA with AMV reversed transcriptive enzyme (TaKaRa) as per the supplier’s instruction ...
-
bioRxiv - Plant Biology 2021Quote: ... and c-DNA was prepared using 2 µg total RNA samples (Takara Bio, UK). The c-DNA samples were diluted ten times and an aliquot of 2 µl of each sample per reaction was used for qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... Transformants were selected on Synthetic Defined (SD) medium lacking Leu and Trp (−2) (Clontech). Three individual transformants were grown overnight in liquid SD (−2 ...
-
bioRxiv - Plant Biology 2021Quote: ... Reactions were performed by mixing 2 μL 5x In-Fusion HD enzyme mix (Clontech), 100 ng of linearized vector ...
-
bioRxiv - Microbiology 2020Quote: ... The 20 μl reaction mixture contained 10 μl 2×TB green Premix DimerEraser (Takara), 1 μl of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... specific primer sets for SARS-CoV-2 and PrimeSTAR GXL DNA polymerase (TaKaRa Bio). The 5’ termini of RNA were amplified by using the 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Biochemistry 2021Quote: ... wt and mutants was induced by treatment with 2 μg/ml Doxycycline (631311, Clontech) for 24-48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was performed using PrimeScript RT Master Mix (CD201-2, TaKaRa, Otsu, Japan), and qPCR was performed using SYBR Premix Ex Taq II (RR820L ...
-
bioRxiv - Immunology 2021Quote: ... The RNA of the SARS-CoV-2 was extracted for reverse transcription (TAKARA, Japan). The SARS-CoV-2 was quantitative analyzed with real time PCR by targeting S protein.
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (Takara, Beijing, China), 0.8 μL of 10 μM bidirectional primers (Table 1) ...
-
bioRxiv - Bioengineering 2023Quote: ... 37°C for 2 hours in a plate coated with Retronectin (Takara Bio, T100B) with an MOI of ∼5.0 for each lentivirus (dCas9 lentivirus at MOI ∼5.0 and gRNA-MCP-fusion effector lentivirus) ...
-
bioRxiv - Neuroscience 2022Quote: ... The titer of AAVs was measured by using AAVproR titration kit ver.2 (Takara).
-
bioRxiv - Cancer Biology 2022Quote: ... 2 µg of plasmids were diluted in 200 µL Xfect transfection reagent (631317, Takara). The mixture was incubated at room temperature for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; Takara, Dalian, China), 0.8 μL of each primer (Table 1) ...