Labshake search
Citations for Takara Bio :
3651 - 3700 of 5103 citations for Serum Zinc Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: NGS transcriptome libraries were generated from 73 healthy baseline samples and 95 convalescence samples using the SMART-Seq v4 Ultra low Input RNA kit (Takara), an optimized version of the SMART-Seq2 method ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized from the RNA using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (Takara Bio Inc, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... both input and IP samples were used for library construction with the SMARTer Stranded Total RNA-seq Kit v2 (634413, Takara), and sequenced by Illumina HiSeq X Ten to produce 150 bp paired-end reads.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... followed by reverse transcription of the enriched mRNA into cDNA using Clontech SMARTer PCR cDNA Synthesis Kit (Takara, Shiga, Japan). PCR cycle optimization was used to determine the optimal amplification cycle number for the downstream large-scale PCR reactions ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was collected from iPSC-derived day 12 cExN and cIN NPCs using the NucleoSpin RNA II kit (Takara) per the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-seq library was generated using the SMART-seq v.4 Ultra Low Input RNA Kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... Isolated RNA was reverse transcribed into cDNA was by Prime Script TM RT reagent Kit with gDNA Eraser (Stratagene, Takara). Real-time PCR was performed on ABI-7500 real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... All the amplicons were cloned into a lentiviral plasmid pCSII–CMV–MCS (RIKEN, RDB04377) by using the In-Fusion HD Cloning Kit (TaKaRa), to produce the pCSII– CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid.
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Immunology 2019Quote: ... all cDNA libraries were constructed and amplified using the SMARTer Stranded Total RNA-Seq Kit (v1 or v2) - Pico Input Mammalian (Clontech) per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... flowthrough and input samples were prepared for sequencing using the SMARTer Stranded RNA-Seq Kit (Takara Bio, Mountain View, CA).
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...
-
bioRxiv - Plant Biology 2019Quote: The amplified fragment was cloned into the XbaI site of pENTR1A (no ccdB) using an In-Fusion HD Cloning Kit (TaKaRa). In the same way ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara) by following the manufacturer’s instruction using gene-specific primers (S2 Table) ...
-
bioRxiv - Immunology 2019Quote: ... JUN-P2A was then subcloned into the XhoI site of MSGV CAR vectors using the In-Fusion HD cloning kit (Takara) upstream of the CAR leader sequence to create JUN-P2A-CAR retroviral vectors ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products were cloned into pBAD28 vector (ATCC® 87400™) by using In-Fusion HD Cloning kit (Takara) by using primers 7 and 8 to amplify pBAD28 vector (Table S2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized from 1.0 μg of each RNA sample using PrimeScript RT Kit with gDNA Eraser (TaKaRa, Dalian, China).
-
bioRxiv - Immunology 2019Quote: ... was added to each sample and first strand full length cDNA was generated with a modified protocol of the SMARTseq v4 Ultra Low Input RNA Kit (Takara Clontech) using poly dT primers and a template switching oligo ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA was subjected to reverse transcription (RT) for 15 min at 37°C with the use of a PrimeScript RT Reagent Kit with gDNA Eraser (Takara), after which the reaction was terminated by incubation at 85°C for 5 s ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing a c-terminal Influenza Hemagglutinin (HA) reporter tag was cloned into the backbone pLX317-empty using the In-Fusion cloning kit (Clontech). The backbone was cut with BamHI and EcoRI.
-
Screening and identification of MicroRNAs expressed in perirenal adipose tissue during rabbit growthbioRxiv - Developmental Biology 2019Quote: ... Six DE miRNAs were reverse transcribed into cDNA using Mir-X™ miRNA First-Strand Synthesis Kits (Takara, Dalian, China) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... 3μg of total RNA was used for reverse transcription with the Prime Script First Strand cDNA Synthesis Kit (Takara, D6110A). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... 250-2000 pg of total RNA was loaded as a template for cDNA synthesis using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech) with template switching technology ...
-
bioRxiv - Biochemistry 2019Quote: ... The ERE sequences of URAT1/SLC22A12 promoter region was amplified to get mutants using PrimeSTAR® Mutagenesis Basal Kit (Takara) with the following primers ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Systems Biology 2020Quote: We extracted RNA from fixed cells after barcode RNA FISH and sorting using the NucleoSpin total RNA FFPE XS kit (Takara). We performed cell lysis and reverse cross-linking at 50°C for 90 minutes and otherwise followed the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5′UTR of test genes and EGFP were inserted into pCAG-FLAG-N1 plasmid 48 using In-Fusion HD Cloning Kit (TAKARA).
-
bioRxiv - Developmental Biology 2021Quote: ... Reverse transcription was performed using 2.5 µl of the RT MasterMix (SMART-Seq v5 Ultra Low Input RNA Kit for Sequencing, Takara Bio). cDNA was amplified using 8 µl of the PCR MasterMix (SMART-Seq v5 Ultra Low Input RNA Kit for Sequencing ...
-
bioRxiv - Immunology 2021Quote: ... Full length cDNA were generated from 4 ng of total RNA using Clontech SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (Takara Bio Europe ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... then removed from the pGEM shuttle plasmid using EcoRI and NotI enzymes and annealed into the DFRS empty plasmid pre-amplified (DFRS empty plasmid primers) and digested by the same enzymes (In-Fusion Kit; Clontech). The control cassette was thus placed on the 3’UTR of the RFP gene.
-
bioRxiv - Neuroscience 2020Quote: ... The RNA was then converted into cDNA and prepared into RNA-seq libraries using the SmarterStranded kit (Takara; Cat#634843). The libraries were size selected for an average fragment size of 300 bp using SPRI beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized and amplified from 100 pg–300 pg of input RNA using SMART-seqTMv4 Ultra Low input RNA kit (Takara Clontech). Sequencing libraries were prepared using the Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Developmental Biology 2021Quote: 1000 FACS-purified cells from TgBAC(tcf21:H2B-Dendra2)ox182 larvae were processed using the SMART-SeqTm v4 UltraTm Low Input RNA Kit for Sequencing (Takara Clontech). Samples were lysed and poly-adenylated RNA reverse transcribed via SMARTScribe Reverse Transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... were reverse transcribed to complementary DNA (cDNA) using both oligo dT and random primers with PrimeScript RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... 500 ng of total RNA was reverse transcribed (complementary DNA (cDNA) was synthesized using PrimeScript™ RT-PCR Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: The target fragments are amplified by PCR using primers (Sangon Biotech, Shanghai, China) and PCR amplification kit (Takara Bio, Japan). The PCR amplifies the DNA fragments including the 1900 bp target ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentivirus was concentrated from supernatant using ultracentrifugation and the genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara).
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription and cDNA pre-amplification were performed using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech/Takara). cDNA was harvested and quantified with the Bioanalyzer DNA High-Sensitivity kit (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were FACS-sorted on a Becton Dickinson FACS Aria cell sorter gating for DAPI−/DRAQ5+/GFP+ cells directly collected in 100 μl of RA1 lysis buffer with 2 μl tris(2-carboxyethyl)phosphine (TCEP) from NucleoSpin RNA XS kit (Clontech).
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...