Labshake search
Citations for Takara Bio :
3451 - 3500 of 5103 citations for Serum Zinc Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The adipocyte-containing liquid was serially applied to a NucleoSpin® Filter Column (NucleoSpin RNA XS Kit, Takara, 740902) for on-column BMA lysis and RNA extraction ...
-
bioRxiv - Immunology 2020Quote: cDNAs were generated from isolated RNAs using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2020Quote: cDNAs were generated from isolated RNAs using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Pathology 2021Quote: ... Complementary DNA was synthesized using the PrimeScript™ RT reagent Kit supplemented with a gDNA Eraser (TaKaRa, Dalian, China) and random primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 1μg of extracting RNA was reverse transcribed into cDNA using the PrimeScript 1st strand cDNA Synthesis Kit (Clontech) according to the manufacture’s specifications ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cDNA was synthesized with 1 ug total RNA using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (TaKaRa). qRT-PCR was performed using a qTOWER3G system (analytikjena ...
-
bioRxiv - Cell Biology 2020Quote: ... The complementary DNA (cDNA) was synthesis via reverse transcription reaction using a PrimeScript RT reagent kit (Takara, South Korea) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... Then singlet and duplet pools were separately ligated overnight into the SuRE barcoded vector using Takara ligation kit version 2.1 (#6022; Takara). Ligation products were purified using magnetic bead purification (#CPCR-0050 ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA was transcribed from 400 ng RNA by the Prime Script 1st Strand cDNA Synthesis Kit (TaKaRa, Germany) and Oligo dT Primer (TaKaRa ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR fragments were inserted into the pHEX2 plasmid (53) using the In-Fusion HD Cloning Plus kit (Clontech). Expression of the transgenes was controlled by the SAG1 promoter and selection was provided by the presence of the HPT selectable marker (50) ...
-
bioRxiv - Microbiology 2020Quote: ... and plasmid backbone fragments were assembled via an In-Fusion® HD Cloning Kit (TAKARA Bio; Kusatsu, Shiga, Japan) to generate the plasmid (oecB- or oecC-pK18-CmR-pheS**) ...
-
bioRxiv - Immunology 2021Quote: ... Isolated RNA was used as input for SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara Bio) and PCR amplification performed ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of RNA per sample was used for first-strand synthesis by SMARTer PCR cDNA Synthesis Kit (Clontech). For quantitative RT-PCR (qPCR) ...
-
bioRxiv - Immunology 2020Quote: ... mice were sorted directly into 8.5μL of lysis buffer supplied with the SMART-Seq v4 Ultra low Input RNA kit for Sequencing (Clontech #634890). Where feasible we matched the number of sorted FDCs (28-342 in unimmunized ...
-
bioRxiv - Molecular Biology 2021Quote: ... The In-Fusion® reaction was performed using the In-Fusion® HD Cloning Plus Kit (Takara Bio, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by ELISA (eBiosciences ...
-
bioRxiv - Genomics 2021Quote: ... we determined the lentiviral integration site using a protocol adapted from Lenti-X Integration Site Analysis Kit (Takara Bio) and oligonucleotides oJY0104-oJY0109.
-
bioRxiv - Biochemistry 2020Quote: ... Amplified genes were cloned into an altered pFastBacHT B vector using the In-Fusion HD EcoDry Cloning Kit (Clontech). After transformation of DH10EMBacY E ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (1 mg) was reverse transcribed using the PrimeScript RT Reagent Kit with the gDNA Eraser (TAKARA, Japan). Quantitative PCR reactions were performed using the gene-specific primers of FLC and FT (Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was isolated as described above and reverse transcribed into cDNA with the prime Script RT reagent kit (Takara). 10 ng of cDNA was used in a 1X reaction consisting of 12.5 µl TB Green Premix Ex Taq II (Tli RNaseH plus ...
-
bioRxiv - Cancer Biology 2020Quote: ... They are routinely tested for contamination of mycoplasma by using PCR Micoplasma Test Kit (Takara Bio Inc., Shiga, Japan) and confirmed to be negative before performing experiments.
-
bioRxiv - Developmental Biology 2022Quote: ... 30 ZP-free embryos were lysed in 1x Lysis Buffer containing RNase inhibitor (0.2 IU/µl, from SMART-Seq Stranded Kit, Clontech), directly ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The MSCV wildtype murine ADAR2 overexpression construct was generated using the In-Fusion HD Cloning Plus kit (Takara Bio). Specifically ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Cancer Biology 2022Quote: ... MG63.3 libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411) while 143b-HOS-GFP libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Immunology 2022Quote: ... Library preparation was performed using the ClonTech SMARTer Stranded RNA-SEq Kit V2 for mammalian pico RNA input (Takara) and RNA sequencing was performed using HiSeq 2500 sequencer with 50bp read lengths (Illumina).
-
bioRxiv - Genomics 2022Quote: Sequencing libraries were prepared using 1-10 ng of cfDNA and the ThruPLEX® Plasma-seq Kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 500 ng total RNA using a Prime Script RT Reagent Kit (Takara Bio, Otsu, Japan). RT- PCR was performed using three primer sets ...
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... The titer of the produced lentivirus was determined by using Lenti-X Gostix Plus Titer Kit (Takara, cat# 631281). To generate AMOT knockdown cell line ...
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Microbiology 2022Quote: ... SMART-Seq v4 Ultra Low Input Kit for Sequencing was used for full-length cDNA synthesis and amplification (Clontech), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... First-stand cDNA was reverse transcribed from 1.5 μg of total RNA using the Prime Script reagent kit (Takara).
-
bioRxiv - Plant Biology 2022Quote: ... ligated into the BamHI and KpnI restriction sites of the pOPINF vector91 using the In-Fusion kit (Clontech Takara) and transformed into chemically competent E ...
-
bioRxiv - Plant Biology 2022Quote: ... ligated into the BamHI and KpnI restriction sites of the pOPINF vector91 using the In-Fusion kit (Clontech Takara) and transformed into chemically competent E ...
-
bioRxiv - Plant Biology 2022Quote: ... The location of T-DNA in mt2 was confirmed by using the GenomeWalker kit (Clontech Laboratories, Mountain View, CA) following the manufacturer’s recommended protocols ...
-
bioRxiv - Plant Biology 2022Quote: ... aril and kernel tissues were pooled equally and cDNA was synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech). Size fractionation and selection (1-2 ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: First-strand cDNA was synthesized from total RNA using the PrimeScript First-Strand cDNA Synthesis Kit with PrimeScript Reverse Transcriptase according to the manufacturer’s protocols (TAKARA). To 1 ug of RNA ...
-
bioRxiv - Neuroscience 2023Quote: cDNA libraries were prepared using the SMARTer® Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio) following manufacturer’s instructions in ten batches ...
-
bioRxiv - Neuroscience 2022Quote: ... purified RNA samples were converted to cDNA using the SMART-seq v4 Ultra Low Input RNA Kit (Takara Bio), and cDNA libraries were generated with the Nextera XT DNA Library Preparation Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was resuspended in cold PBS and titre was determined using Lenti-X p24 Rapid Titre Kit (Takara Bio) according to manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA-seq libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara, 634412). Libraries were sequenced on the Illumina MiSeq platform ...