Labshake search
Citations for Takara Bio :
301 - 350 of 6602 citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... total mouse liver mRNA (Takara) was used.
-
bioRxiv - Molecular Biology 2020Quote: ... the genome of Pv11 cells and the clonal cell lines were extracted with a NucleoSpin Tissue kit (Takara Bio, Shiga, Japan) and subjected to PCR using the following primer set ...
-
bioRxiv - Immunology 2019Quote: ... Total RNA was isolated from the cells using an RNA Extraction Kit (Takara, Japan) and then reverse-transcribed to cDNA using the PrimeScript RT Master Mix Kit (Takara ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA was purified from Ax2 cells with the NucleoSpin Tissue kit (Takara Bio). The following plasmids were gifted by Dr ...
-
bioRxiv - Biochemistry 2020Quote: ... the cells were harvested for analysis using Guide-it™ sgRNA Screening Kit (TaKaRa). Stable I2PP2A knockdown CRISPR I2PP2A HEK293 cells were also maintained in MEM with 10% FBS supplemented with Gentamycin (50 mg/ml).
-
bioRxiv - Microbiology 2020Quote: RNA was extracted from Vero cells using the NucleoSpin RNA kit (Takara Bio Inc.), and cDNA was synthesized with the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio Inc.) ...
-
bioRxiv - Immunology 2021Quote: ... Target cell death was quantified with an LDH (lactate dehydrogenase) cytotoxicity assay kit (Clontech) using the manufacturer’s recommended protocol ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA was isolated from cells using Trizol RNA isolation kit (Takara, Shiga, Japan) and MDR1 and GAPDH transcripts were detected using a TransScript Green One-Step qRT-PCR SuperMix (TransGen Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... coli DH5⊡ competent cells and isolated using a midi-prep kit (Takara Bio, 740420.10), and validated by gel electrophoresis.
-
bioRxiv - Genetics 2019Quote: Viral RNA was extracted from cell suspensions using a Viral RNA Extraction Kit (TaKaRa) and following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: NK cell activity was quantified using the LDH Cytotoxicity Detection Kit (MK401, TaKaRa, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from cells using the NucleoSpin® RNA kit (Cat# 740955.50, Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Immunology 2024Quote: CD8+ T-cells were exposed to the SMARTerTM RACE cDNA Amplification Kit (Clontech/Takara) to identify and annotate ROPN1/B epitope-specific TCRα- and β-chains based on Kunert et al ...
-
bioRxiv - Microbiology 2024Quote: ... as well as from various feline cell lines using an RNAiso Plus kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Synthesised cDNA was used for analysing the expression of specific genes using gene specific primers (as given in supplementary table 1) in presence Taq polymerase master mix (EmaraldAmp GT PCR Master mix, Takara, Japan).
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Zoology 2019Quote: ... Gene specific primers listed in supplementary information were used in quantitative RT-PCR reactions containing SYBR green master mix (Takara #RR820). The Ct values were used to calculate Fold Change against spike-in control lncRNA (see results for details ...
-
bioRxiv - Molecular Biology 2020Quote: Specific DNA sequences were PCR amplified using gene specific primers and cloned into vectors using PrimeSTAR HS DNA polymerase (#R010A, Takara-bio) and T4 DNA ligase (#M0202S ...
-
bioRxiv - Bioengineering 2020Quote: ... with specific primers (Suppl. Table 1) from pP121K-AcGFP1 [15] and inserted between the SalI and BglII sites of pTRE3G (Takara Bio) using NEBuilder HiFi DNA Assembly Mater Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... the coding sequences of DivIVA and its T19A and T19E mutant alleles were PCR amplified using sequence-specific primers (Table 1) and cloned at BamHI-KpnI sites in pDsRed plasmid (Clontech Inc.) yielding pDsD4A and pDsD4AT19A ...
-
bioRxiv - Immunology 2022Quote: ... for continuous fluorescence detection in a total volume of 10 μL of cDNA/control and gene-specific primers using SYBR Premix Ex Taq (TaKaRa Bio). The mRNA levels of the target genes were normalized relative to those of Gapdh using the following formula ...
-
bioRxiv - Zoology 2020Quote: ... Diluted cDNA was amplified using gene-specific primers (Table 1) and the TB Green real-time PCR master mix (TaKaRa, Japan). RT–PCR was used to verify the accuracy of the RNA-Seq data and detect the mRNA expression of the MYL2 gene in tissues and C2C12 cells at least in triplicate with specific paired primers.
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... For gene analysis the cDNA was amplified using gene specific primers by qPCR with Takara 2X SYBR Green Mix (Takara RR420A) and analyzed in real time PCR machine (7500 Applied Biosystems) ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR products were amplified with specific primers based on the off-target sites and purified products were cloned into pMD19-T vector (TaKaRa, Japan) for Sanger sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR reaction was performed with a Biorad CFX384TM Real Time System PCR machine and forward and reverse gene-specific primers (0.5 μM, Table S2) using the SYBR® Premix Ex Taq™ (Tli RNaseH Plus) from Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... and the expression of specific gene was analysed using TB Green® Premix Ex Taq™ II (TaKaRa Bio Inc., Japan) in a Roche Light Cycler 480 with predesigned and validated primers from PrimerBank of Massachusetts General Hospital (61) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was then subjected to the real time PCR for specific gene target by TB Green Premix Ex Taq (TaKaRa, RR420B) according to manufacturer’s instructions using Real Time PCR system (SIS-PCR005 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Amplification of cDNA product was performed using specific primers with the TB Green® Premix Ex Taq™ II (Takara, RR820B) on a Real-Time PCR detection system (BioRad) ...
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Systems Biology 2020Quote: ... proteins in whole cell extract and immunoprecipitated fractions were digested with 2 mg/mL proteinase K (Takara Bio Inc., Kusatsu, Japan) at 42°C for 2 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilized metal affinity chromatography (IMAC using Talon resin; Takara Bio). The buffer used during the purification process was 20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: Protein-protein interactions were assayed with the Matchmaker yeast two-hybrid system (Clontech, Mountain View, CA). ORFs of AoHse was amplified from first-strand cDNA of A ...
-
bioRxiv - Neuroscience 2020Quote: Enhanced green fluorescent protein (EGFP, Clontech), Tag-blue fluorescent protein (Tag-BFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... protein was estimated using BCA (TaKaRa), and 100 µg protein was incubated with 20 µl packed protein G-sepharose beads (Sigma P3296 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA was prepared from EV RNA using the Single Cell RNA kit SMART-Seq_V4 Ultra Low Input RNA Kit (634890, Takara, Mountain View, CA, USA) according to manufacturer instructions using 1ng input ...
-
bioRxiv - Neuroscience 2020Quote: Bacterial expression plasmids encoding mouse and human WT-α-synuclein in the inducible pRK172 backbone were transformed into BL21-CodonPlus (DE3) cells (Clontech). Cell pellets were lysed in 0.75M NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Only 0.5 µL of media containing cumulus cells from each mouse was added to 10 µL lysis buffer (Takara Bio Inc.). The oocytes were then treated with 1 mg/mL collagenase to remove the ZP ...
-
bioRxiv - Developmental Biology 2021Quote: ... was inserted in a Tol2 vector containing the hsp70l:xxxp2a-TFP sequence (kind gift from Prof. B. Martin, Stony Brooks University, NY) by In Fusion (Clontech) cloning ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The α1-subunit genes were inserted at the PH promoter of vectors already containing the corresponding β1-subunit proteins using In-Fusion® HD Cloning Kit (Takara Bio, USA Inc.) and control sequenced ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories, Inc.). The cloning mixtures were transformed to One Shot™ TOP10 Chemically Competent E ...
-
bioRxiv - Biochemistry 2021Quote: ... an aliquot of the lysate was used to measure protein concentration by BCA protein assay (Takara Bio). The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer) ...
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Cell Biology 2019Quote: ... Mouse Ca14 coding sequence was amplified from mouse B16 cDNA and cloned in mcherryN1 vector (Clontech) in KpnI/HindIII site ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were prepared using a French press and susequent protein purification accomplished using Talon metal affinity resin (TaKaRa Bio USA, Inc.) as described by the manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Inducible expression of a Nef-eGFP fusion protein was established in CEM-T4 cells using the Lenti-XTM Tet-On System (Clontech now Takara Bio USA) which places expression of Nef-eGFP under the control of a doxycycline-inducible promoter ...
-
bioRxiv - Molecular Biology 2021Quote: Plasmids were extracted from yeast cells by Easy Yeast Plasmid Isolation Kit (#630467, Takara Bio) and transformed into E ...