Labshake search
Citations for Takara Bio :
451 - 500 of 6602 citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-GFP (JL-8 clone, Takara Bio) or mouse anti-alpha-tubulin (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Molecular Biology 2019Quote: ... or a mouse α-GFP antibody (632381, Takara) to a dilution of 1:2000 in Odyssey Blocking Buffer (PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNAs from Mouse Total RNA Master Panel (Takara) were reverse-transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... we used the normalized mouse brain library (Clontech Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse GFP (1:4,000, Living Colors, 632380, Clontech) and rabbit β-Actin (1:3,000 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-GFP (1:200; PA; Clontech). Alexa Fluor 488- ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies: mouse antimCherry (Clontech, Cat. No. 632543), chicken antiGFP (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mouse anti-SPARC/Osteonectin (ON1-1, Takara) for 1 h at RT ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was extracted from cells using the NucleoSpin RNA II kit (Clontech Laboratories, Mountain View, CA, USA). The quality and quantity of total RNA were measured by Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA was extracted from sorted T cells using the Macherey-Nagel NucleoSpin Tissue XS kit (Takara #740901.250). DNA encoding the CAR costimulatory domain was amplified from the extracted genomic DNA using the forward primer 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNACTGGTTATCACCCTTTA CTGC-3’ (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2021Quote: RNA from FACS-sorted cells ranging from 3,000 – 10,000 were isolated with the NucleoSpin RNA XS kit (Clontech) with on column DNase digestion according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... cells and medium were collected and AAV particles were purified by AAVpro Purification Kit (Takara Bio; Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: cDNA was generated from single cells in the 96-well plate using the SmartSeq v4 kits (Takara Bio) using 1/4th volume reactions dispensed using a Mantis dispenser (Formulatrix) ...
-
bioRxiv - Biochemistry 2019Quote: ... Lentivirus was produced by transient transfection of HEK 293T cells using the CalPhos mammalian transfection kit (Clontech laboratories) to introduce packaging vectors (VSVg and GAG/POL/Δ8.2 ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from wild-type or transiently transfected cells with MiniBEST Universal RNA Extraction Kit (Takara), an additional DNase I (NEB ...
-
bioRxiv - Cell Biology 2021Quote: Total genomic DNA of HeLa cells was extracted after irradiation using Total genomic DNA extract kit (TAKARA, China). Human nuclear GAPDH gene (forward ...
-
bioRxiv - Immunology 2020Quote: cDNA from sorted cells was generated using the SMART-Seq v4 Ultra low input RNA kit (Clontech # 634890) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were sorted directly into buffer for SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories, Inc.). Subsequent processing was carried out by the UCL Genomics sequencing facility ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18-20 μg of indicated plasmids were transfected in HEK293T cells using the CalPhos Mammalian Transfection Kit (Takara). After 48h ...
-
bioRxiv - Biochemistry 2023Quote: ... Genomic DNA from WT and Strt1−/− cells was extracted with a NucleoSpin Tissue kit (Takara Bio, Shiga, Japan) and subjected to PCR using specific primers (Oligonucleotide sets 3 ...
-
bioRxiv - Cell Biology 2023Quote: cDNA was synthesized from the total RNA of HapT1 cells using the PrimeScript RT Reagent Kit (Takara Bio). The amounts of Pts and Actb were quantified on a LightCycler 480 (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: Single-cell cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) according to the manufacturer’s protocol with some modifications as previously described17 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from drug/vehicle-treated cell lines using NucleoSpin RNA kit (Takara, Catalog no. 740955.50). 2 ug of total RNA was used to synthesize cDNA with qScript Ultra Supermix (Quantabio ...
-
bioRxiv - Microbiology 2021Quote: ... per recipient CFUs and confirmed the transconjugants by PCR detection of vanA and erm(B) genes,22,23 and by SmaI-PFGE (Takara Bio Inc., Shiga, Japan).24
-
bioRxiv - Cancer Biology 2022Quote: ... The converted cDNA was amplified using gene-specific primers and TB Green® Premix Ex Taq™ II (Cat# RR820A; DSS Takara Bio India Private Ltd) to quantify the expression of the genes using a real-time PCR system (Applied Biosystem Quant Studio 7 Flex ...
-
bioRxiv - Cell Biology 2021Quote: ... a plasmid expressing enhanced green fluorescent protein (EGFP) (Clontech), or in another series of experiments with pVSV-G ...
-
bioRxiv - Biophysics 2020Quote: ... The protein was initially purified using Talon resin (Clontech) with a linear gradient of 50 to 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using TALON Metal Affinity Resin (Clontech) and dialyzed overnight against PBS buffer ...
-
bioRxiv - Immunology 2020Quote: ... The protein concentration was determined by Bradford assay (Takara), and the cell lysate was mixed with 4x Laemmli loading buffer containing β mercapto-ethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... Bound proteins were detected using Hyper HRP Substrate (Takara). PtIns(3,5)P2 Grip protein (P-3516-3-EC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Proteins were bound to TALON SuperFlow IMAC resin (Takara) overnight ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... These plasmids were transformed into the yeast strain AH109 for testing protein-protein interaction using the Matchmaker Gold system (Takara Bio, Kusatsu, Japan). Yeast transformation and growth were performed as described in [Pecher et al. ...
-
bioRxiv - Molecular Biology 2020Quote: DOM-A and DOM-B cDNAs were cloned into pENTR3c vector (Thermo Fischer Scientific, Cat. No A10464) by In-Fusion Cloning (Takara Bio, Cat. No 638909) using LD35056 ...
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA).
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were transfected with given plasmids and then harvested for RNA extraction by NucleoSpin RNA Plus Kit (Takara) 48 hour after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and pBS2_Pericentrin C-ter_InsR: CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were converted to cDNA and amplified using Smart-Seq V4 Ultra Low Input RNA Kit (Takara Bio). The cDNA output was then processed with Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcribed RNA from sorted cells was generated by SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio). Real-time PCR was performed using a Fast SYBR green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by ELISA (eBiosciences ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2022Quote: ... and a subset (approximately 75,000 cells) was pelleted prior to RNA extraction using the NucleoSpin RNA Plus XS kit (Takara) following manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: TUNEL assays were performed to detect apoptotic cell death using Clonetech ApoAlert DNA Fragmentation kit (Takara, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: cDNA was amplified from the collected cells using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech-TakaraBio). 1ng of amplified cDNA was used to generate barcoded libraries with the Nextera XT DNA library preparation kit (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... Full-length cDNAs were generated directly from ~10,000 cells per sample using oligo(dT) priming and the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech), and 150 pg of cDNA was used to prepare strand-specific paired-end sequencing libraries (Nextera XT ...