Labshake search
Citations for Takara Bio :
251 - 300 of 750 citations for Tumor necrosis factor receptor superfamily member 3 LTBR Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Cell Biology 2021Quote: ... and the mouse Mon1b cDNA was amplified from the Marathon-Ready adult mouse brain and testis cDNAs (Clontech/Takara Bio, Shiga, Japan) by conventional PCR techniques ...
-
bioRxiv - Cell Biology 2021Quote: ... and the mouse Mon1b cDNA was amplified from the Marathon-Ready adult mouse brain and testis cDNAs (Clontech/Takara Bio, Shiga, Japan) by conventional PCR techniques ...
-
bioRxiv - Microbiology 2021Quote: ... mouse monoclonal antibody against EGFP (Clontech, Mountain View, CA) was used for western blotting at a dilution of 1:1,000 and rabbit polyclonal antiserum reactive against protein kinase A (PKA ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: ... incubated with α-MYC (mouse, 1:500, Clontech #631206) in 4 % BSA-PBS for 60 min at room temperature to stain surface expressed GluK2 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (JL8 - Takara cat# 632381, RRID: AB_2313808), mouse anti-E-cadherin (HecD1-provided by M ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (632375, Takara Bio Inc., Otsu, Japan), mouse anti-FLAG (F3165 ...
-
bioRxiv - Neuroscience 2020Quote: ... we used the normalized mouse brain library (Clontech Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... mouse monoclonal antibody against EGFP (Clontech, Mountain View, CA) was used for Western blotting at a dilution of 1:1,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse monoclonal anti-GFP (Clontech; milk; 1:2,000).
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-DSRed (targeting mCherry; 1:2000; Clontech), washed ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-GFP JL-8 (cat. no. 632381, Takara) used at a concentration of 1:2,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... membranes were incubated with mouse anti-GFP (Clontech #632380), rabbit anti-DsRed (Takara #632496) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti GFP (mouse monoclonal, JL8, Clontech; WB: 1:6000), anti-human tubulin (mouse monoclonal ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry 1:100 (Takara Bio Clontech 632543), mouse anti-GFP 1:250 (Abcam Ab1218) ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse monoclonal anti-GFP (JL8, Clontech, 632381, 1:1000) mouse monoclonal anti-vinculin (SantaCruz ...
-
bioRxiv - Biophysics 2024Quote: ... and blotted with anti-GFP/YFP antibody (mouse, Clontech) at 1:5000 dilution overnight at 4° C on a rocking platform ...
-
bioRxiv - Microbiology 2020Quote: ... human NLRP1 TEV or mouse NLRP1B (mouse strain 129 allele, NCBI accession AAZ40510.1) were cloned into the pQCXIP vector backbone (Takara Bio, Mountain View, CA) with a C-terminal Myc tag ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA fragments larger than 3 kb were amplified with PrimeSTAR Max (Clontech Laboratories, Inc.); all other PCR products were amplified with PrimeSTAR HS DNA polymerase (Clontech Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-3-3τ and β-actin were designed and synthesized by Takara (Table 1). To run the real-time PCR reaction ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
bioRxiv - Genomics 2020Quote: ... as well as the Mouse total RNA Master panel (Clontech), were used to study the level of expression of candidate lncRNAs ...