Labshake search
Citations for Takara Bio :
451 - 500 of 750 citations for Tumor necrosis factor receptor superfamily member 3 LTBR Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Genomics 2024Quote: ... Supernatant containing viral particles was harvested after 2 and 3 days and concentrated 100x using Lenti-X concentrator (Takara) following manufacturers instructions.
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... to OD600 0.2–0.3 with 2–3 mL fresh AYE +Fe +Cys containing 40 ng/mL anhydrous tetracycline (aTC, Clontech 631310). On the third day ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibodies used for this study were: mouse anti-GFP JL-8 (Clontech, 1:3000), rabbit anti-PfEF1α (from D ...
-
bioRxiv - Immunology 2020Quote: Mouse tail DNA was amplified using KAPA Taq PCR Kit (Takara Bio, cat. R040A) and primers Rosa26 WT F ...
-
bioRxiv - Genetics 2019Quote: ... Enzyme immunoassays were used to measure plasma concentrations of mouse Glu-Osteocalcin (MK129;Takara), mouse Gla-Osteocalcin (MK127 ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from mouse testis and the whole brain was either obtained from Takara or prepared from 100 mg of testis tissue from 3-month old WT and βV KO C57BL/6J animals with Trizol reagent (Chomczynski & Mackey ...
-
bioRxiv - Cell Biology 2021Quote: ... We probed the blot with Mouse anti-GFP (JL8, Living Colors, Takara, 1:3000) or Mouse anti Ds-Red (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2022Quote: ... The following primary antibodies were used: 1:2000 mouse anti-GFP (RRID:AB_2313808, 632381, Clontech); 1:2000 mouse anti-3V5 (RRID:AB_2556564 ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... GFP-tagged full-length mouse Creb3l3 cDNA was inserted into pEGFP (GFP-CREB3L3) (Clontech), mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP fusion proteins were revealed with mouse monoclonal antibody anti-GFP (JL-8, Clontech) used at 1/2000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: Total RNAs of mouse tissues were extracted by TRIzol reagent (Takara Bio, Tokyo, Japan), then were used for cDNA synthesis with HiScript® II Q Select RT SuperMix for qPCR (Vazyme Biotech Co. ...
-
bioRxiv - Cell Biology 2023Quote: cDNAs of mouse Upf3a and Upf3b were amplified with PrimeSTAR® HS Premix (Takara) from an E14.1 ES cell cDNA library ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: mouse anti-GFP JL-8 (1:1000; TaKaRa), mouse anti-Tubulin AA4.3-c (1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... the mouse monoclonal anti-GFP (Jl-8, Clontech; 1:500 overnight at 4°C) primary antibody was used ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibody was used in this study: mouse anti-GFP (JL8, Takara). Goat anti-mouse (A32730 ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... reverse transcription was initiated from the bridge 3’ OH by adding 2 μL SMARTScribe Reverse Transcriptase (100 U/ μL, Clontech) and incubating for 1 h at 42 °C with shaking at 800 rpm ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers P5 and P6 were annealed to create a dsDNA molecule encoding the sgRNA sequence with 5’ and 3’ extensions to enable InFusion Cloning (Clontech) into BtgZI-digested pL6 ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... interaction test and plasmid isolation were performed using the Yeast Protocols Handbook and Matchmaker GAL4TM Two-hybrid System 3 & Libraries User Manual (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... cerevisiae strains used for yeast two-hybrid analysis were Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech) and Y2H Gold (MATa ...
-
bioRxiv - Plant Biology 2021Quote: ... medium and 10-fold dilutions of these cultures were dropped on SD control (−2) and selective medium additionally lacking His (−3) (Clontech). Empty vectors were used as negative controls ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sgRNA target locus on exon 3 or 5 was PCR amplified with Terra™ PCR Direct Polymerase Mix (Takara) for 35 cycles using primer sets mEX3F and mEX3R or mEX5F and mEX5R (Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... These nanowells were selected for subsequent targeted deposition of 50□nl/nanowell RT-PCR reaction mix from the SMARTer ICELL8 3’ DE Reagent Kit (Takara) using the MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-GGC ATG GAC GAG CTG TAC AAG TCC AAT TTA CTG ACC GTA CAC-3’ and on pEGFP-C1 (Clontech) with primer ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).