Labshake search
Citations for Takara Bio :
251 - 300 of 1390 citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... mouse DPPA3 cDNA was sub-cloned into a pGEX4T-3 plasmid using In-Fusion (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA-seq libraries for gene expression were constructed using Clontech SMARTer v.3 kit (Takara). Small RNA libraries were constructed using NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μl of cold Poly-A-tailing master mix (3.3x Smartscribe first strand buffer (Takara), 0.16 U/μl Poly-A-polymerase (2180A ...
-
bioRxiv - Cancer Biology 2022Quote: ... to the 3’ end of the GFP at the PmeI site using InFusion Cloning (TaKaRa) and screened with PCR and restriction digests (Supplementary Table S8) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µL of ligation mix were transformed into 15 µL Stellar Competent cells (Takara 636763) and plated on AMP LB selection plates followed by overnight incubation at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Cell Biology 2020Quote: The GST-Bbs5 was expressed for 3 h at 27 °C in Escherichia coliBL21(DE3) (Takara) transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara) ...
-
bioRxiv - Cancer Biology 2020Quote: ... ICELL8® 3’ DE Chip was then imaged on an ICELL8® Imaging System (Takara Bio) featuring an Olympus BX43 upright florescent microscope equipped with an automated stage ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 h and 0 h before extracting total RNA by MiniBEST Universal RNA Extraction Kit (Takara). The abundances of the interest genes were detected measured in each time point by real-time quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2021Quote: Yeast two-hybrid assay was conducted using Matchmaker GAL4 two-hybrid system 3 (Clontech/Takara, USA). Bait and prey vectors were co-transformed into the yeast strain AH109 (Clontech/Takara ...
-
bioRxiv - Cancer Biology 2021Quote: Yeast two-hybrid assay was conducted using Matchmaker GAL4 two-hybrid system 3 (Clontech/Takara, USA). Bait and prey vectors were co-transformed into the yeast strain AH109 (Clontech/Takara ...
-
bioRxiv - Molecular Biology 2020Quote: Adenovirus vectors were generated with the Adeno-X Adenoviral System 3 following manufacturer’s instructions (Takara, #632267). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: Yeast two-hybrid analysis was performed using the MatchMaker GAL4 Two-Hybrid System 3 (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... yeast two-hybrid analyses were performed using the Matchmaker GAL4 Two-Hybrid System 3 (Clontech Laboratories). S ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutant 3×FLAG-tagged hRubicon vectors were generated using an in-Fusion reaction (TaKaRa Bio). The mCherry-tagged mRubicon was subcloned into pMRX-IRES-bsr ...
-
bioRxiv - Plant Biology 2024Quote: ... and the primers listed in Supplementary Table 3 applying the In-Fusion cloning method (Takara Bio) according to the manufacturer ...
-
bioRxiv - Biophysics 2024Quote: ... we purified only long concatemers using electrophoresis in 0.3wt% PrimeGel Agarose GOLD 3-40K (TaKaRa Bio).
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Yeast two-hybrid experiments were carried out using the Matchmaker GAL4 Two-Hybrid System 3 (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The Chip was then centrifuged at 1200xg for 3 min into a collection tube (Takara Cat# 640048). To remove residual PCR primers and detergent ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Plant Biology 2020Quote: Yeast two-hybrid analysis was employed using the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio, Japan) as previously described (Umezawa et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were diluted to 25,000 cells/mL and dispensed into ICELL8 3’ DE chips (Takara Bio, CA) using an MSND device (Takara Bio) ...
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was bound to 3 mL (=1.5 mL bed volume) Talon SuperFlow Metal Affinity Resin (TaKaRa) per protein preparation ...
-
bioRxiv - Molecular Biology 2022Quote: The yeast two hybrid assay was performed as indicated in MATCHMAKER GAL4 two-hybrid system 3 (Clontech). The protein coding regions of genes used in this study were amplified from Guy11 cDNA with primer pairs listed in Table 1.1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genome fragments of each AQP gene were PCR-amplified using MightyAmp DNA polymerase ver.3 (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Products with 3’-dA overhangs were cloned into T-Vector pMD19 (Simple) (Takara Bio Inc., Shiga, Japan) to use as a template for sequencing.
-
bioRxiv - Plant Biology 2024Quote: ... total RNA was extracted from 3-week-old seedlings with Minibest plant RNA extraction kit (Takara, 9769) and three independent biological replicates were performed ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 3-week-old seedlings with Minibest plant RNA extraction kit (Takara, 9769) and three independent biological replicates were performed ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell lysate (∼ 50 mL) was loaded onto a 1.5 mL (3 mL slurry) TALON Superflow resin (Clontech) pre-equilibrated with equilibration buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...