Labshake search
Citations for Takara Bio :
451 - 500 of 1390 citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed in a 10 µL reaction volume containing 5 µL of 2× SYBR Premix Ex Taq (RR420A, Takara), 1 µL of diluted cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of cDNA was used together with specific forward and reverse primers for primary miR-43093 (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... Total normal liver RNAs were obtained from 5 donors pool (Biochain, Newark, CA) and from 4 donors pool (Takara BioUSA, Mountain View, CA, USA). 3 μg of total RNA were used for reverse transcription to obtain cDNA and real-time PCR performed ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Bioengineering 2024Quote: ... to a final concentration of 5 µg/mL and 2 µg/mL doxycycline (631311, Takara Bio USA, Inc., Mountain View, CA, USA) for the first 7 days after seeding ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Immunology 2024Quote: ... DTT (5 mM, Takara), recombinant RNase inhibitor (1 U/uL ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 (Takara, #6045) according to manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 (Takara Bio).
-
bioRxiv - Immunology 2022Quote: ... version 2 (Takara). Fastq files were generated from bcl files using BCL2FASTQ v2.17.1.14 with default parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... 4 U RNAse inhibitor (Takara, 2313A), 10mM dNTPs (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’RACE was carried out using a 5’ Full RACE Core Set (Takara Bio). The first PCR was performed using the single strand cDNAs concatenated by T4 RNA ligase and primers S1 (5’-TTC TAT ACC ATC GTC TAC CCG CTG AGC TTC-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: The 5′ RACE analysis was conducted using the 5′ -Full RACE Core Set (Takara), according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... pVSV-G (PT3343-5, Clontech) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pEco (Takara, #PT3749-5). Cells transduced with the retrovirus were sorted for EGFP positive by flow cytometry ...
-
bioRxiv - Neuroscience 2020Quote: ... and Doxycycline (5 μM, Clontech) on day 4 ...
-
bioRxiv - Neuroscience 2020Quote: ... and Doxycycline (5 μM, Clontech) on day 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Cell Biology 2024Quote: ... pVSV-G (PT3343-5, Clontech) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2020Quote: ... 5’ ends of the viral genome were analyzed by 5’-Full RACE Core Set (TaKaRa) and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega ...
-
bioRxiv - Genetics 2022Quote: The 5’end of the cloned fragment was amplified with a 5’RACE kit (Takara). The 5’RACE adaptor in the kit was used to evaluate the mRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Microbiology 2024Quote: ... PrimeScript reverse transcriptase (4 µl) (Takara, #2680B), and filtered water (6 µl ...
-
Gain-of-function study reveals the pleiotropic roles of serine protease HtrA in Borrelia burgdorferibioRxiv - Microbiology 2024Quote: ... 5′-RACE was carried out using SMARTer RACE 5’ Kit (Takara Bio USA, Mountain View, CA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 Units of ExTaq enzyme (Takara) supplemented with 10 μM of ATTO-550-aminoallyl-dUTP (Jena bioscience) ...
-
bioRxiv - Cell Biology 2023Quote: ... and pVSV-G (#PT3343-5, Clontech) vectors were transfected using Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5) cDNA coding eGFP protein (Clontech). 6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5× PrimeScript™ RT mix (TaKaRa) was used to acquire cDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.