Labshake search
Citations for Takara Bio :
2651 - 2700 of 2788 citations for 6 4 METHOXY PHENYL 3 METHYL IMIDAZO 2 1 B THIAZOLE 5 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg total RNA was used for cDNA synthesis using RNA to cDNA EcoDry™ Premix (double-primed) kits (Clontech, UK). qRT-PCR reactions were performed in triplicate using a Corbett Rotorgene 6000 Real-Time PCR machine with Sensimix SYBR No-Rox (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Membrane was blocked overnight in 5% milk-TBS + 1% Tween and incubated the next day with a primary antibody directed against the Gal4-activation domain (1:5,000 dilution; Clontech, cat # 630402) or against human Ku70p (1:1,000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... Single-round replication-incompetent HIV-1 produced from J-Lat-EnTr cells was harvested 48hr post TNF-α treatment and concentrated via Lenti-X-Concentrator (Clontech). J-Lat-EnTr-BFP cells co-cultured with Jurkat-GFP cells produced single-round replication-incompetent HIV-1 produced via TNF-α treatment for 72hr ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNAs were synthesized from 1 μg total RNA using the Prime Script™ RT reagent kit (Perfect Real Time; Takara). All qRT–PCR (quantitative reverse transcription–PCR ...
-
bioRxiv - Immunology 2021Quote: ... and the NES sequence of the HIV-1 rev protein into pT2ADW vector (Komatsu et al., 2018) by In-Fusion cloning (Takara Bio).
-
bioRxiv - Neuroscience 2021Quote: ... Cells were cotransfected with hSyn-DsRed and the indicated construct on DIV 7 or DIV 19 (for older neurons) with 1 μg total purified plasmid DNA via CalPhos Mammalian Transfection Kit (Takara Bio) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: Amplicons comprising the 5’intron of exon 3 of Sp140 and the end of exon 3 were amplified from crude DNA from ear clips of B6 and Sp140-/- 1 mice (sense: TCATATAACCCATAAATCCATCATGACA; antisense: CCATTTAGGAAGAAGTGTTTTAGAGTCT) with PrimeStar PCR components (Takara, R010b) for 18 cycles according to manufacturer specifications ...
-
bioRxiv - Biochemistry 2022Quote: The expression plasmid for N-terminal 6×His-tagged mCherry-Nter was constructed by inserting the sequence encoding DmAgo2 Nter (residues 1–398) amplified from the native DmAgo2 sequence into pCold I (TAKARA Bio) using the InFusion HD cloning kit (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: hCEC were transduced with pHAGE-DD-KNL1Mut-dCas9 and a sgRNA vectors and DD-KNL1Mut-dCas9 was stabilized with 100 nM Shield-1 (Takara, #632189) for 9 days ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of total RNA was reverse transcribed into cDNA using PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Japan). qRT-PCR was performed with Roche LightCycler 480 Real Time PCR system (Roche ...
-
bioRxiv - Synthetic Biology 2022Quote: Single point mutations in all mOptoT7 plasmids were based on previously published plasmids (mOptoT7 Version 1, V1)53 and created using CloneAmp HiFi PCR Premix (Takara Bio). All constructs were transformed into Top10 E ...
-
bioRxiv - Genetics 2022Quote: ... An aliquot of 1 μg of the total RNA was used to synthesize cDNA using PrimeScript™ RT reagent Kit with gDNA eraser (Takara). qRT-PCR analysis was performed on a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 5,000 bp upstream sequences flanked the start codons of the MpSGFs were amplified from MpTak-1 genomic DNA using PrimeSTAR GXL polymerase (Takara Bio) and cloned into a linearized pENTR1A vector using In-fusion (Takara Bio) ...
-
bioRxiv - Neuroscience 2024Quote: ... sandwiched in between 300 bp each of repeat-adjacent upstream and downstream sequence from C9orf72 intron 1 and then inserted it into the internal MCS of pCDH-EF1-MCS-IRES-copGFP with InFusion cloning (Takara Bio) in between XbaI and NotI restriction sites ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The mixture (1 μL) was used as the template in 10 μL of PrimeSTAR GXL DNA Polymerase (Takara Bio Inc., Japan) reaction ...
-
bioRxiv - Immunology 2024Quote: ... A total of 1 μg of total RNA was reverse-transcribed with random primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2024Quote: ... that were exposed immediately after infection and for about 44 to 48 h to 1 μg/mL Anhydrotetracycline (631310, TaKaRa, ATc) whereas control cultures were exposed to vehicle only (100% ethanol).
-
bioRxiv - Genomics 2024Quote: Illumina sequencing libraries are prepared by incorporating 1-10 ng of cfDNA with the ThruPLEX® Plasma-seq Kit by Takara Bio ...
-
bioRxiv - Immunology 2024Quote: ... Two-step PCR to amplify gag or pol region was performed with eight different primer pairs (Supplemental Table 1) and Ex-Taq (TaKaRa-Bio) as described previously (17) ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed on 1 µg total mRNA per sample using PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used for the purpose of inserting Capn4 into pCWX200 and pLexA were ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 μg of total RNA was reverse-transcribed with random primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then the isolated RNA (1 μg) was reverse transcribed into cDNA (20 μL) using PrimeScript™ RT Master Mix (Perfect Real Time, Takara). The qPCR reaction was initiated at 95 °C for 3 min ...
-
bioRxiv - Immunology 2023Quote: ... total RNA (1 ng) was injected into the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, Palo Alto, CA, USA) for sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... An amount of 1 μg RNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (Takara Biomedical Technology, China). For RT-qPCR ...
-
bioRxiv - Plant Biology 2023Quote: ... Each sample of total RNA (1 mg) was reverse transcribed by the PrimeScriptTM RT reagent Kit with gDNA Eraser (cat no. RR047A, Takara, Japan). The resistance genes examined were the same as those investigated in our previous study 9.
-
bioRxiv - Biochemistry 2023Quote: ... The amplified vector was gel purified (1% agarose) and used for In-Fusion® HD cloning (Clontech, Mountain View, CA, USA) with amplified and gel purified (2% agarose ...
-
bioRxiv - Genomics 2023Quote: ... purified via gel extraction from a 1% agarose gel followed by cleanup using the NucleoSpin PCR clean up and gel extraction kit (Takara Bio). Linearized CROP-seq-optiI and amplified oligonucleotides were assembled using the NEBuilder HiFi DNA assembly cloning kit (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 cycles of 98 °C for 10 sec followed by 68 °C for 1 min using PrimeSTAR HS DNA Polymerase with GC buffer (Takara, R044A). The primers used were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentivirus was produced in DMEM containing 10% FBS and 1% BSA and then concentrated by the Lenti-X concentrator (Takara Bio).
-
bioRxiv - Genomics 2023Quote: ... RNA (1 ng) was used for cDNA synthesis and amplification using the SMART-Seq HT RNA-Seq library amplification kit (Takara Bio). According to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... A bead ratio of 1x was used (50 µL of AMPure XP beads to 50 µL cDNA PCR product with 1 µL of 10x lysis buffer added, as per Clontech instructions), and purified cDNA was eluted in 17 µL elution buffer provided by Clontech ...
-
bioRxiv - Neuroscience 2023Quote: ... The expression of GFP- or Venus-tagged constructs was measured by Western blot with mouse anti-GFP antibody (Clontech; 1:2,000). The expression of WT and mutant arrestin-3 was measured with rabbit polyclonal anti-arrestin-3 antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... Brains were sectioned into 1000-μm coronal slices under microscopy and the sections were floated in 1% BSA-PBS (Nacalai Tesque, #0128197 and Takara, #T9181). The PVH was dissected based on the fluorescence of tdTomato in OT-Cre ...
-
bioRxiv - Neuroscience 2023Quote: ... in PBS and then incubated overnight with gentle agitation at 4 °C in blocking solution plus 1:1000 dilution primary antibody (chicken anti-GFP polyclonal, Abcam; rabbit anti-dsRed polyclonal, Takara Bio). Sections were then incubated covered with gentle agitation for 2 hours at room temperature in blocking solution plus 1:500 dilution secondary antibody (goat anti-rabbit IgG Alexafluor 594 conjugate ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were transfected with the aforementioned pX330 vectors together with pEGFP-C1 (#6084-1, Clontech Laboratories, Mountain View, CA, USA) and cultured for 2 d ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cloning reactions were performed at 50 °C for 1 h using the In-Fusion® HD Cloning Kit (Takara Bio). The reaction mixtures were further transformed into TG1 electrocompetent cells (Lucigen) ...
-
bioRxiv - Immunology 2024Quote: ... The cDNA of shp-1 was obtained by reverse transcription of liver total RNA and subcloned into Hind III/BamH I (Takara, Japan) sites of pcDNA3.1EGFP vector ...
-
bioRxiv - Plant Biology 2020Quote: ... After 1 μg of total RNA from leaves was reverse-transcribed using a High Fidelity PrimeScript™ RT-PCR Kit (Takara, Japan), and Real-time qRT-PCR was performed using a Thermal Cycler Dice® Real Time System III T950 (Takara ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 days post-treatment the vehicle control flasks had DNA from 1×108 cells per replicate isolated with Nucleobond CB 500 kit (Takara Bio 740509) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... First-strand cDNA was synthesized from 1 μg of total RNA using Oligo(dT) RNA to cDNA EcoDry Premix (Takara, Dalian, China). Primers used for qRT-PCR were designed using Primer 3Plus online software (http://bioinformatics.nl/cgi-bin/primer3plus ...
-
bioRxiv - Cell Biology 2022Quote: Mitochondrial network morphology was assessed transfecting hPASMC grown on a 60 mm plate to 50% confluence with 1 μg pDsRed2-mito expression vector (Clontech Laboratories, 632421) and 2 μL Lipofectamine™ 2000 (ThermoFisher Scientific ...
-
bioRxiv - Pathology 2020Quote: The viral loads of WHCV in BALF of patient 1 were determined by quantitative real-time RT-PCR with Takara One Step PrimeScript™ RT-PCR Kit (Takara RR064A) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... we washed the slides with PBT (this buffer was also used in subsequent washing steps) and incubated them in primary antibody (rabbit anti-DsRed, 1:100, Clontech, no. 632496) at 4 °C overnight ...
-
bioRxiv - Pathology 2019Quote: ... pMuNoV-MNV-1 was constructed by exchanging the MNV sequence portion from MNV-1 to MNV-S7 with the In-Fusion cloning system (Takara Bio Inc.), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA (1 µg) was reverse transcribed into First-strand complementary DNA using a PrimeScript RT reagent kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions and stored at –20°C.
-
bioRxiv - Microbiology 2021Quote: ... HEK293T cells grown in 10 ml of medium (3.0 x 105 cells/ml) were transfected with 10 µg of pCAGGS-NP (1-450) using TransIT-293 Reagent (Takara, Shiga, Japan). Three days post-transfection ...
-
bioRxiv - Neuroscience 2021Quote: The following antibodies were used for immunohistochemistry with dilution ratios as indicated: rabbit anti-DsRed (1:1,000, Clontech cat# 632496, RRID: AB_10013483), mouse anti-BRP (1:100 ...