Labshake search
Citations for Takara Bio :
2301 - 2350 of 2788 citations for 6 4 METHOXY PHENYL 3 METHYL IMIDAZO 2 1 B THIAZOLE 5 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μg was reverse-transcribed using PrimeScriptTM RT Reagent Kit (perfect Real Time) (Takara). RT-qPCR was performed with qPCRBIO SyGreen Mix LoRox polymerase (Cultek ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSF-DUET-1-EIF6 construct was used to express eIF6 and the pTf16 (Takara Biosciences) construct was used to express the TF chaperone ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products and pGEX6P-1 vector were digested with EcoRI (Takara Bio, Shiga, Japan) and NotI (Takara Bio ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were treated with 200 ng ml−1 of Dox (#631311; TaKaRa, Kusatsu, Japan) for 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were pre-treated 1 hour prior to the assay with A/C Heterodimerizer (Takara) diluted at 1:200 in complete media concurrent with JF-Halo or -SNAP dye labeling ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... 10 ng cDNA in a 25 μl reaction mixture containing 1 X ExTaq buffer (TaKaRa), 200 μM each of NTP and 800 nM of primers along with 0.625 units ExTaq HS (TaKaRa ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µg of total RNA was converted to cDNA using M-MLV reverse transcriptase (TAKARA) under standard conditions with oligo(dT ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
bioRxiv - Microbiology 2023Quote: ... the media was replaced and supplemented with 1 μg/mL aTc (Clontech catalog number 631310). After 24 h induction ...
-
bioRxiv - Genomics 2024Quote: Synthetic gRNAs (1-2ng) were sequenced by SMARTer smRNA-seq kit from Takara (Cat #635030). Original oligo-dT protocol is modified and first cDNA was synthesized directly with 1µl of tailed scaffold primer (10µM ...
-
bioRxiv - Cell Biology 2024Quote: HCT116 cells were transfected with 1µg of either pEGFP Actin vector (Clontech Catalog #6116-1) or pEGFP Actin C374S or pEGFP N1 vector (Clontech Catalog #6085-1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was extracted from pool of 30 embryos at 1 dpf using trizol reagent (Takara), chloroform (Sigma Cat ...
-
bioRxiv - Genetics 2024Quote: ... The detailed protocol was described in the manufacturer’s handbook (Yeast protocols handbook; PT3024-1; Clontech).
-
Exploratory mass cytometry analysis reveals immunophenotypes of cancer treatment-related pneumonitisbioRxiv - Immunology 2024Quote: ... The resultant cell pellets were then resuspended in Cellbanker 1 cryopreservation solution (Takara, catalog #210409). This suspension was aliquoted into cryovials and gradually frozen to –80°C and stored at –80°C until required for experimental analysis ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 μg RNA was reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). The cDNA was then amplified for further analyses using deep sequencing on Illumina NextSeq platform ...
-
bioRxiv - Genetics 2021Quote: ... prepare non-tissue culture treated plates by adding RetroNectin (1 μg/μL; Takara Bio, Otsu, Japan) to enhance transduction efficiency ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was reverse transcribed using the Perfect real-time cDNA reverse transcription kit (TaKaRa). Quantitative PCR was performed with 1 μg of cDNA per sample per target gene using AceQ qPCR SYBR Green master mix (Vazyme ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of PB-Tet-On Advanced (containing PiggyBac Transposon sequences57 flanking rtTA-Advanced (Takara Bio) and puromycin selection cassette) ...
-
bioRxiv - Plant Biology 2021Quote: ... and the GFP fusion proteins were detected using the JL-8 (Clontech, 632380; 1:2500 dilution) as the primary antibody and an HRP-conjugated Affinipure Goat Anti-Mouse antibody (Proteintech ...
-
bioRxiv - Plant Biology 2021Quote: ... The gRNA - dCas9 complex was amplified (primers in Supplemental Table 1) and In-Fusion cloned (Clontech) into a SacI digested pMJS064 (described above ...
-
bioRxiv - Microbiology 2021Quote: ... HSV-1 strain KOS pUL21 (UniProt F8RG07) or truncations thereof was cloned into pEGFP-N1 (Clontech) for expression with a C-terminal GFP tag or into pEGFP-C2 (Clontech ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized from 1 μg of total RNA using an RNA reverse transcriptase kit (Takara). Real-time qPCR was performed using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA (1 μg) was reversed to cDNA with PrimeScript™ RT reagent Kit (Takara, RR047Q), which was performed according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and each reaction contained 1 μl of cDNA and the SYBR Green PCR mix (Takara, RR420A), to which gene-specific forward and reverse PCR primers were added ...
-
bioRxiv - Neuroscience 2021Quote: ... hLAG3 expression was then induced by addition of 1 µg/ml of Doxycycline (DOX; Clontech #631311) 3 weeks (4 week DOX on conditions ...
-
bioRxiv - Neuroscience 2022Quote: ... media was collected and concentrated 1:10 in 1xPBS using Lenti-X concentrator (Takara Bio, #631231), aliquoted ...
-
bioRxiv - Cell Biology 2019Quote: ... 2016) using anti-GFP (Living Colors A.v. peptide antibody, rabbit polyclonal, 1 mg/ml; TakaraBio/Clontech) primary antibody and horseradish peroxidase linked anti-rabbit IgG (from donkey ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Developmental Biology 2020Quote: ... dissected calvaria from 9SL or 11SL fish were labeled with antibodies against mCherry (Takara, 1/100), GFP (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was prepared with 1 µg RNA and synthesized using the Primescript RT kit (Takara Inc.). qPCR assays were performed on the StepOnePlusTM Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2019Quote: ... pRFP-N1 was constructed by replacing of GFP in the pEGFP-N1 (Clontech, Catalog # 6085-1) with RFP ...
-
bioRxiv - Cell Biology 2020Quote: ... gDNA of CFU colonies was extracted by suspending the cell in 1×PCR buffer (Takara, R050A) containing 0.2mg/ml proteinase K (Tiangen ...
-
bioRxiv - Immunology 2020Quote: ... EqPD-1 and EqPD-L1 cDNAs were amplified by PCR using TaKaRa Ex Taq (Takara Bio) and specific primers (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... Input and elution samples were analyzed by immunoblot using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Genetics 2022Quote: Full length wild-type or mutant BRC-1 sequences were cloned into plasmid pBridge (Takara Bio), transformed into yeast strain Y2HGold (Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... then incubated overnight with the primary antibody rabbit anti-dsRed (1:1000 in PBST; Clontech, AB_10013483) at 4°C ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: Myristoylated TdTomato (myr::TdTom) was labeled with 1:500 rabbit anti-DsRed (Takara Cat# 632496, RRID:AB_10013483)
-
bioRxiv - Plant Biology 2024Quote: ... 1 μg of total RNA was reverse transcribed using SMART® MMLV Reverse Transcriptase (Clontech, www.clontech.com) using oligo(dT)15 primers ...
-
bioRxiv - Plant Biology 2024Quote: ... Both PHI-1 ORF and CESAs ORFs were amplified from first-strand DNA with PrimeScriptRTase (TaKaRa) using primers indicated in Supplemental information 4 ...
-
bioRxiv - Neuroscience 2024Quote: ... The following primary antibodies were used for staining: anti-FOXG1 (rabbit, Takara, M227, 1:400 dilution), anti-TCF7L2 (rabbit ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was directly loaded into a gravity column filled with 1 mL TALON resin (TaKaRa) pre-equilibrated with the binding buffer (20 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... The fluorescent proteins were probed with anti-GFP monoclonal (JL8, 1:2,000 dilution; TaKaRa Bio Inc.) and anti-RFP polyclonal (PM005 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were added to the blocking solution (Rabbit anti-DsRed 1:1000, stock #632496, Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies and dyes were used at following dilutions: rabbit-α-dsRed (1:500, Takara, #632496; RRID:AB_10013483), α-HRP conjugated with Alexa Fluor-488 (1:250 ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression of GADD34Δ and K3L was induced by adding 1 µg/ml of doxycycline (Takara). After one additional day ...