Labshake search
Citations for Takara Bio :
2601 - 2650 of 5125 citations for Medium Kit without Serum and with CultureBoost since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The titer of adenovirus was examined using an Adeno-XTM Rapid Titer Kit (Takara Bio USA) and determined to be 3.4 × 1011 ifu/ml ...
-
bioRxiv - Immunology 2022Quote: TCR repertoire profiling was performed using the SMARTer TCR α/β Profiling Kit (Takara Bio, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... site-directed mutagenesis of gPLT2 was performed using the in-fusion HD cloning Kit (Takara Bio). The further reactions followed the in-fusion HD cloning Kit manual (Takara Bio) ...
-
bioRxiv - Plant Biology 2023Quote: Yeast one-hybrid assays were performed using the Matchmaker Gold Yeast One-Hybrid System Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2024Quote: ... following the manufacturer’s instructions and used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa).The sequences of FaMyo5 motor domains were amplified from the cDNAs of all the F ...
-
bioRxiv - Plant Biology 2024Quote: ... The first-strand cDNA synthesis was performed with the Prime Script RT Master Mix kit (Takara). Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411). Single-end sequencing was performed on the Ilumina NovaSeq platform with a sequencing depth of 80 million reads and a read length of 100 bp.
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA was obtained by using the PrimeScript RT Reagent Perfect Real Time kit (Takara, Japan). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... was reverse-transcribed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Molecular Biology 2024Quote: ... and plasmid DNA was isolated using NucleoSpin® Plasmid (NoLid) kit for miniprep (740499.250; Takara Bio) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A, Takara) on a Light Cycler Real-Time PCR System (480II ...
-
bioRxiv - Microbiology 2024Quote: ... after which DNA was extracted using the NucleoSpin Microbial DNA kit (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry tsa1 mutant alleles were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... coli total RNA using SMARTer smRNA-Seq Kit for Illumina (Cat# 635029, Takara Bio, Shiga, Japan). Libraries were quality-checked on the Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... we synthesized the first-strand cDNA using the PrimeScript 1st-strand cDNA synthesis kit (TaKaRa, Japan). The qRT-PCR was conducted in a 20μl reaction volume employing SYBER Green Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2023Quote: ... Site-directed mutagenesis at the CESA1 sequence was performed using the infusion cloning kit from Takara Bio ...
-
bioRxiv - Microbiology 2024Quote: ... and 20 or 25 uL were assayed using either the Great EscAPe SeAP kit (Takara/Clontech) or the Phospha-Light System (Applied Biosystems).
-
bioRxiv - Microbiology 2024Quote: ... and 20 or 25 uL were assayed using either the Great EscAPe SeAP kit (Takara/Clontech) or the Phospha-Light System (Applied Biosystems).
-
bioRxiv - Evolutionary Biology 2024Quote: ... rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA Amplification Kit (Clontech). For LhGAP3 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). The projection-specific neurons was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). The projection-specific neurons was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Genomics 2023Quote: ... Eluted DNA was prepared as sequencing libraries with the ThruPLEX-FD Prep Kit (Takara bio, # R400675). Libraries were sequenced with 150-BP PE on an Illumina HiSeq 2500 Sequencing platform at Novogene.
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was used for library preparation with SMARTer® StrandedTotal RNA-Seq Kit v3 (Takara Bio) with rRNA removal and sequenced on Illumina Novaseq 6000(50 bp paired-end mode ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids for producing XccOpgD mutants were constructed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and was retrotranscribed to cDNA with PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, RR047A). Real-time quantitative RT-PCR (qPCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviral titration was performed by RT-qPCR using the Lenti-X qRT-PCR Titration Kit (Takara) and the concentration of lentivirus used for this paper was found to be above 1 × 107 copies / mL ...
-
bioRxiv - Biochemistry 2023Quote: ... and then reverse transcribed into cDNA using PrimeScript II 1st strand cDNA synthesis kit (Takara Bio). PCRs for AgApiT and FNS I (Yan et al ...
-
bioRxiv - Microbiology 2023Quote: ... One microgram of RNA was transcribed into cDNA using the PrimerScript RT Reagent Kit (Takara, Japan). After reverse transcription ...
-
bioRxiv - Systems Biology 2023Quote: ... The total cfRNA library was prepared by SMARTer® Stranded Total RNA-Seq Kit – Pico (TaKaRa). Libraries were sequenced on Illumina HiSeq X-ten (~37.5 million paired-end reads per library ...
-
bioRxiv - Systems Biology 2023Quote: ... The PBMC RNA library was prepared by SMARTer® Stranded Total RNA-Seq Kit – Pico (TaKaRa). All libraries were sequenced on Illumina HiSeq X-ten (~38.8 million per library ...
-
bioRxiv - Synthetic Biology 2023Quote: Amplicons were prepared for sequencing using Takara ThruPLEX® DNA-Seq Kit (Takara Bio, cat #R400674), which included unique dual indexing ...
-
bioRxiv - Neuroscience 2023Quote: ... Physical and functional titers were obtained using the Lenti-X qRT-PCR Titration Kit (Takara 631235) and qPCR of genomic DNA following HEK293T transduction91 ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... in-situ apoptosis detection kit and TB Green Premix Ex Taq II were procured from Takara Bio Inc ...