Labshake search
Citations for Takara Bio :
201 - 250 of 410 citations for SARS Coronavirus Spike Glycoprotein S1 His Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... which was generating by replacing a V5 tag with an eGFP or DsRed (Clontech) tag from pcDNA3.1-nV5-DEST vector (Invitrogen) ...
-
bioRxiv - Biochemistry 2019Quote: ... The DNA libraries were prepared using a SMARTer ThruPLEX Tag-seq Kit (Takara Bio), and the samples were sequenced on an Illumina HiSeq1500 system.
-
bioRxiv - Microbiology 2020Quote: ... HSP70-F2/R2 primers (Table S1) and ligated into pBS-SK+ using the In-fusion HD Cloning kit (Clontech, Beijing, China), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Plant Biology 2020Quote: ... The RAV1 motif enriched promoter sequence of each of the gene (Table S1) was cloned in pAbAi bait vector (Clontech, USA) in the upstream of Aureobasidine A ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of Arfs were amplified by PCR (primers listed in Suppl. Table S1) and inserted into the pQXCIP plasmid (Takara Bio) using the AgeI and BamHI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... the 3′ terminus of each strand of dsRNA was ligated with PC3-T7loop oligo (Table S1) using T4 RNA ligase (TaKaRa, China) at 16 °C for 16 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Neuroscience 2022Quote: AAVs were packaged via calcium phosphate transfection of HEK293 cells as detailed in (McClure et al 2011) and purified using an AAVpro purification kit (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP 61,62 (400ng) using TransIT-LT1 (Takara, Cat# MIR2306). On day 3 (24 hours post transfection) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Both soluble and insoluble (cell pellet) fractions were purified via His-IDA nickel column (Clontech Laboratories ...
-
bioRxiv - Genetics 2022Quote: ... Colonies were grown on media lacking histidine and leucine (DO Supplement -His/-Leu, Takara Bio) to select for the presence of both vectors ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the SMARTer Stranded Total RNA HI Mammalian kit (Takara 634873) with 0.5-1ug of RNA and samples were sequenced on the NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... which was inserted into pAcGFP-His- MAP2C 11-308 by In-Fusion cloning kit (Takara). pAcGFP-His-MAP2C-Tau was chimera of MAP2C_M1-L311 and Tau0N4R_P193-L383 in the numbering Tau0N4R ...
-
bioRxiv - Plant Biology 2023Quote: ... The yeast transformants were grown on nutrient-restricted (without Trp, Leu, His, Ade) mediums (Clontech) 3-5 days to assess interactions between various protein combinations.
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Cell Biology 2019Quote: ... or mKate2 (Shcherbo et al., 2009) tags by homologous recombination via In-fusion Cloning (TaKaRa). 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... the hexa-histidine tag was replaced with a SnapTag by In-Fusion cloning (Takara Bio). pCI-SEP-NRI was a gift from Robert Malinow (Addgene plasmid # 23999 ...
-
bioRxiv - Cell Biology 2020Quote: ... Importin α with an N-terminal FLAG tag was cloned into pLVX-TetOne-Puro (Clontech) to generate stable cell lines ...
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Plant Biology 2023Quote: ... truncatula A17 using the primers MtU6.6_prom_InF_F1 and MtU6.6_prom_InF_R along with the guide cassette fragment amplified from pKSE401_RR using the primers pKSE401_empty_InF_F2 and pKSE401_InF_R2 (Table S1) and the amplified fragments were assembled into the HindIII digested pKSE401_RR vector backbone using In-Fusion cloning (Takara Bio, Kusatsu, Japan).
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... the nine pmW118 plasmid vectors were subjected to amplification of the cDNA fragments (F1-F9-10) of SARS-CoV-2 XBB.1 and XBB.1.5 by PrimeSTAR GXL DNA polymerase (Takara) with the primer sets24 ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2020Quote: ... The E.coli-expressed tNPR1-His protein was extracted and purified using TALON Metal Affinity Resin (Clontech). For rabbit immunization ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases ...
-
bioRxiv - Molecular Biology 2019Quote: ... the fragment were ligated into the Xho I and Bam HI sites of pEGFP-N3 (Clontech), creating Aβ fused in frame to the N-terminus of GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... pAcGFP-His-MAP2C without AcGFP was amplified and Dendra2 was amplified from pDendra2-C vector (Takara). Dendra2 was inserted into where AcGFP was by In-Fusion cloning kit ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... coding sequences were amplified by PCR from zebrafish cDNA using specific primers (Table S1) and subcloned into mCherry-C1 vector (Clontech, Mountain View, CA). hVPS4A in pEGFP-C1 was previously described in Elia et ...
-
bioRxiv - Genomics 2022Quote: ... Extracted RNA from each juvenile (as described in Methods S1) was converted to cDNA using PrimeScript RT-PCR Kit (Takara Bio, Shiga, Japan). The efficiency and specificity of the designed primers was tested through PCR using the GoTaq Green Master kit (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... The genes were amplified with [AgApiTpCold_F and R] and [Agr35256-2_F and R] primer sets (Supplemental Table S1) and cloned into the NdeI/XbaI sites of the pCold ProS2 vector (Takara Bio, Kusatsu, Japan). The resulting plasmid was transformed into E ...
-
bioRxiv - Neuroscience 2021Quote: ... Ank only) rat Shank3 with a C-terminal mRFP-tag were generated in pmRFP-N3 (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (Univ ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... covering the full-length SARS-CoV- 2 genome were amplified by PCR using a PrimeSTAR GXL DNA polymerase (TaKaRa Bio), the synthesized cDNA and specific primer sets from CoV-2-G1-Fw to CoV-2-G10-Rv designed previously (21) ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RNA quantification was performed by RT-qPCR targeting the S gene of SARS-CoV-2 using One Step PrimeScript RT-PCR Kit (Takara) with the following SARS-CoV-2 specific primers and probes ...
-
bioRxiv - Pathology 2021Quote: ... Expression of the GST-N protein of SARS-CoV-2 was induced by isopropyl-D-1-thiogalactopyranoside (0.3 mM IPTG, Takara Bio). The cell pellets were sonicated ...
-
bioRxiv - Microbiology 2022Quote: ... Ct values were obtained from PCR tests conducted as administrative tests at the Toyama Institute of Health using the SARS-CoV-2 direct detection RT-qPCR test kit from Takara Bio Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...