Labshake search
Citations for Takara Bio :
101 - 150 of 410 citations for SARS Coronavirus Spike Glycoprotein S1 His Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Virus containing supernatants were harvested five times from transfected Ecopack-HEK293 cells (Clontech/Takara), over a period of three days post-transfection and filtered with 0.45 µm filters ...
-
bioRxiv - Cell Biology 2022Quote: ... GST tags were cleaved by HRV-3C Protease (Takara), which released the recombinant proteins from the beads ...
-
bioRxiv - Molecular Biology 2019Quote: ... an alkaline phosphatase (AP) tag (pSEAP; Clontech, CA, USA) was linked to the N-terminus of PAR1 cDNA (F2R ...
-
bioRxiv - Microbiology 2022Quote: ... a set of primer/probe E484A (SARS-CoV-2) (Takara, Cat# RC322A) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... or its derivatives with appropriate antibiotics resistant genes (ampicillin for Escherichia coli and neomycin or puromycin for mammalian cells) and a tag (SNAP-tag or HaloTag) using an In-Fusion HD Cloning Kit (639635, Takara Bio, Shiga, Japan). The E ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara, Cat# MIR2300) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... the CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara, Cat# MIR2300) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... the CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara, cat# MIR2300) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... HEK293T and CHO-K1 cell lines were ordered from American Type Culture Collection (ATCC) and HEK293-tetON cells and CHO-tetON cells were purchased form Clontech (Takara Bio). Synthetic DNA was ordered from Twist Bioscience.
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses containing guide RNAs targeting GORAB were created in HEK293 Lenti-X cells (Takara 31966021) plated on 10 cm dishes the day before transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Immunology 2024Quote: ... His-tagged CD45RO was purified by TALON affinity resin (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... We inserted a green fluorescent C-terminal tag (EGFP; Clontech) analogous to a procedure used in a previous study [34] (for details ...
-
bioRxiv - Cell Biology 2021Quote: ... which encodes the chaperone protein tag (TaKaRa Bio, Shiga, Japan), following the manufacturer protocol ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases, Takara Bio DO Supplement -His/-Leu). Cultures were grown to saturation ...
-
bioRxiv - Microbiology 2021Quote: ... Complete nucleoprotein and glycoprotein genes were amplified using Takara long amplicon Taq polymerase with GC buffers (RR02AG Takara Bio USA, Mountain View, CA, USA) using the primers indicated in Table 1 after cDNA synthesis using random hexamer primers and Roche AMV reverse transcriptase (10109118001 Roche ...
-
bioRxiv - Microbiology 2020Quote: ... The Spike ectodomain was purified by immobilised metal affinity chromatography using Talon resin (Takara Bio) charged with cobalt followed by size exclusion chromatography using HiLoad 16/60 Superdex 200 column in 150 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... The Spike ectodomain was purified by immobilized metal affinity chromatography using Talon resin (Takara Bio) charged with cobalt followed by size exclusion chromatography using HiLoad 16/60 Superdex 200 column in 150 mM NaCl ...
-
bioRxiv - Bioengineering 2023Quote: HEK293 cells (JRCB Cell Bank, Osaka, Japan) and AAVpro 293T cells (Takara Bio Inc., Shiga, Japan) were cultured in Dulbecco’s modified Eagle Medium (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2019Quote: ... Western blotting was performed with anti-6×His mouse mAb (Clontech), with secondary IRDye 800CW goat anti-mouse (LI-COR ...
-
bioRxiv - Neuroscience 2021Quote: ... His-tagged Cbln1 were purified by Talon metal affinity resin (Clontech) and dialyzed against HBSS ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified with Capturem™ His-Tagged Purification Maxiprep Kit (Takara). The binding reaction was performed in 20 μL binding buffer (10 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... specific primer sets for SARS-CoV-2 and PrimeSTAR GXL DNA polymerase (TaKaRa Bio). The 5’ termini of RNA were amplified by using the 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Immunology 2021Quote: ... The RNA of the SARS-CoV-2 was extracted for reverse transcription (TAKARA, Japan). The SARS-CoV-2 was quantitative analyzed with real time PCR by targeting S protein.
-
bioRxiv - Molecular Biology 2020Quote: ... Each cDNA was then amplified by Per2AS specific primers (Table S1) together with the Universal Primer (Clontech). The first PCR products were subsequently amplified by the nested Per2AS specific primers with Universal Primer (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... E.coli competent cells transformed with pTf16 chaperone protein tag (TaKaRa Bio) per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... the CPER products were transfected into HEK293-hACE2/hTMPRSS2 cells by using TransIT-LT1 (Takara, Cat# MIR2305). At one day post-transfection ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Microbiology 2019Quote: ... IN and CCD proteins were loaded onto a His-TALON column (TAKARA), and the columns were washed with IN wash buffer (20 mM HEPES pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were purified using Capturem™ His-Tagged Purification kit (Takara Bio), then dialyzed by PBS buffer overnight ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting fragment was cell-free cloned into pNI-His (Takara Bio) for expression in B ...
-
bioRxiv - Biophysics 2021Quote: ... His-tagged QUEEN protein was bound to TALON Metal Affinity Resins (Clontech) at 4°C ...
-
bioRxiv - Microbiology 2021Quote: abTse3-His was cloned into vector pET28a by In-Fusion (Takara Bio). E ...
-
bioRxiv - Microbiology 2020Quote: ... and spotted on SD supplemented with -Leu/-Trp/-His DO supplement (Clontech) (SD-Leu-Trp-His ...
-
bioRxiv - Molecular Biology 2021Quote: ... transferred onto nitrocellulose and detected with either mouse anti-6×His (Clontech) at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tagged proteins were purified with His60 Ni Superflow resin (TaKaRa; 635677) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... embedding and immunogold staining using a 6×His monoclonal antibody (Takara Bio) diluted 1/5000 as the primary antibody ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was then performed using gene-specific primers (Table S1) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S ribosomal RNA gene (OL4498 and OL4449 ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of FRT-FP plasmids were constructed (Fig. S1) using the mammalian expression backbone pCMV-N1 (Clontech). FRT-F13 ...
-
bioRxiv - Genomics 2022Quote: ... DNA samples that were shortened to the appropriate size were blunted with S1 nuclease (Cat# 2140, Takara Bio) and T4 DNA polymerase (Cat# 2040 ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA sequences of CHIKV 6K and TF (Supplementary Figure S1) were cloned in the pEGFPC1 vector (Clontech) to generate fusion proteins tagged with the Enhanced Green Fluorescent Protein (EGFP ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 infected patients were confirmed using a RT-qPCR kit (TaKaRa, Dalian, China) as recommended by the China CDC.
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Bioengineering 2019Quote: Sequencing libraries were prepared using the ThruPLEX Tag-seq Kit (Takara Bio). 10 μL of samples from NanoDeep assays (performed on SPR surfaces or cells ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 cells were transfected with pX330 vector together with an EGFP-containing plasmid (pEGFP-N1; Clontech Laboratories, Inc). Single cells were sorted using a FACS Vantage SE machine and the knockouts confirmed by sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... The transfection efficiency of HEK293 cells was evaluated by transfecting cells with EGFP-N1 (Clontech; Mountain View, CA) in parallel reactions ...
-
bioRxiv - Neuroscience 2022Quote: All viruses were made using the 2nd generation lentiviral packaging systems in Lenti-X HEK293 FTT cells (Takara). Lenti-X cells were passaged maximum 3 times before being used for virus production in HEK media (High glucose DMEM with 4 mM GlutaMAX ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Plant Biology 2019Quote: The 5’ ends of the viral genomes sequences were determined or confirmed using the 5’ Rapid Amplification of cDNA Ends (RACE) strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech ...
-
bioRxiv - Cell Biology 2021Quote: Point mutation primers were designed (Table S1) for PCR using 42B3-scFv as a template with Prime STAR (TaKaRa). KOD one PCR Master Mix Blue (Toyobo ...