Labshake search
Citations for Takara Bio :
201 - 250 of 2288 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2024Quote: ... version 2 (Takara cat. no. 634411). After sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg/mL doxycycline (Clontech, 631311), 0.5 mM lysine ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length of itga2 was inserted into the Sfi IA (5′-GGCCATTACGGCC-3′) and Sfi IB (3′-GGCCGCCTCGGCC-5′) sites of the “prey” pPR3-C vector (Clontech). Series of combinations of bait and prey constructs were cotransformed into the yeast strain NMY51 (Clontech) ...
-
bioRxiv - Molecular Biology 2024Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned in plasmids derived from the 2 hybrid vectors pGADT7 (GAL4-activating domain) and pGBKT7 (GAL4-binding domain) creating N terminal fusions and transformed in yeast haploid strains Y187 and AH109 (Clontech), respectively ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2020Quote: ... University of York) in frame with an N-terminal His tag and Im9 solubility tag (37) using In-Fusion cloning (Takara). Primers used for gene amplification were 5’-TCCAGGGACCAGCAATGCTTTCTGAGGAAGAGCAAAAAC-3’ and 5’-TGAGGAGAAGGCGCGTTAAAAGCGATAGCGGTAGCGGATG-3’ for UBA1a ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Human GABRB3 (IMAGE ID 3871111, Source BioScience) were used to obtain N-terminal GST fusions in pGEX-KG (Clontech) or N-terminal FLAG fusions in pJEN1 (pcDNA3 derived ...
-
bioRxiv - Cell Biology 2020Quote: ... the sequence of NAGTI-GFP (N-acetylglucosaminyltransferase I fused to GFP; (Shima et al., 1997)) was cloned into pLVX-TetOne-Puro (Clontech). The constructed plasmid was then co-transfected with psPAX and pVSVG into HEK293T cells to produce lenti-viruses ...
-
bioRxiv - Microbiology 2020Quote: ... ORF68 and its homologs were subcloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal) using InFusion cloning (Clontech) (Addgene #x-x) ...
-
bioRxiv - Cell Biology 2021Quote: ... an additional set of genes encoding pTF.CREG1 with N-terminal truncations (Δ26, Δ31, Δ39, Δ43) was generated by PCR using PrimeStar GXL DNA Polymerase (Takara Bio), primer sets JT33/JT32 ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion of the predicted helix motif in the hCAP-H N-tail was performed using PrimeSTAR Mutagenesis Basal Kit (TaKaRa). Primers used in the deletion were as follows ...
-
bioRxiv - Microbiology 2022Quote: MHV68 FLAG tagged ORF45 and ORF65 were subcloned into the XhoI and NotI sites of pcDNA4/TO-3xFLAG (N-terminal tag) to generate pcDNA4/TO-3xFLAG-ORF45 or ORF65 using InFusion cloning (Clontech). ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Microbiology 2022Quote: ... ORF45 and ICP0 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF45 using InFusion cloning (Clontech). Deletion mutants of 2xStrep-ORF45 were generated using site-directed mutagenesis PCR with Q5 DNA Polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Biophysics 2023Quote: ... A plasmid expressing mouse GR tagged in the N-terminus with mCherry was developed by amplifying mouse GR coding sequence and in-frame cloning in pmCherry-C3 (Clontech). Point mutations and deletions were introduced using the Quickchange XL mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Neuroscience 2024Quote: ... and a single transmembrane region from human IL2RA (UniProt accession number: P01589) were fused to the N-terminus of KCNQ2 or KCNQ3 using the In-Fusion HD Cloning Kit (Takara). Site-directed mutations were introduced into KCNQ2 and KCNQ3 by standard PCR techniques using PrimeSTAR Max DNA Polymerase (Takara) ...
-
bioRxiv - Cell Biology 2024Quote: ... full-length IQGAP1 was tagged at the N terminus with tandem enhanced green fluorescent protein (EGFP) and inserted into pEGFP-C1 (Clontech) at a BglII and SmalI site ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...