Labshake search
Citations for Takara Bio :
451 - 500 of 2288 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µl of SYBR® Premix Ex Taq (Tli RNase H Plus) (Takara) and run in a CFX connect instrument (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... Yeast transformation was conducted with Yeast Transformation System 2 (Clontech NO.630439). All primers used were listed in supplementary Table 1.
-
bioRxiv - Microbiology 2020Quote: ... 2 µl of dNTP mix (TaKaRa, 2.5 mM concentration, 200 µM final), 0.125 µl of HotStart ExTaq (TaKaRa ...
-
bioRxiv - Biochemistry 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Cell Biology 2021Quote: ... before loading into a TALON® 2 ml Gravity Column (Takara 635606). Columns were washed one additional time before elution in a single step (150 mM Imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... a set of primer/probe E484A (SARS-CoV-2) (Takara, Cat# RC322A) was used ...
-
bioRxiv - Microbiology 2022Quote: ... 1µl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 30 cycles according to the manufacturer’s instructions (forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTP and 2 U/mL of recombinant RNase inhibitor (Clontech) then spun down and frozen at −80°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Immunology 2020Quote: ... Whole transcriptome amplification (WTA) was performed with Advantage 2 polymerase (Takara Bio). WTA reactions were monitored with qPCR to determine optimal cycle number ...
-
bioRxiv - Synthetic Biology 2021Quote: ... After 2 days of incubation on selective media (SC-URA/630314/CLONTECH) at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... cerevisiae strain BJ5464 using protocol Yeastmaker™ Yeast Transformation System 2 (Clontech). The transformants were screened on yeast nitrogen base (YNB ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were then treated with 2 μg/mL puromycin (Clontech; 631306) under selection for at least 1 week ...
-
bioRxiv - Neuroscience 2022Quote: ... Lentiviruses were purified and concentrated using the LentiX Concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... then cells were selected with 2 μg/ml puromycin (631306; Takara Bio) or 500 μg/ml geneticin (10131027 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at-80°C ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was amplified and purified using an Advantage 2 PCR Kit (Clontech). The cDNA library was sequenced using an Illumina sequencing platform (NovaSeq6000) ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was incubated with 2 ml Ni-IDA resin (Takara Bio) for 2 hrs at 4°C ...
-
bioRxiv - Microbiology 2024Quote: YTHA was performed using the MATCHMAKER Two-Hybrid System 2 (Clontech, USA) as described previously (20) ...
-
bioRxiv - Cancer Biology 2024Quote: 1,000,000 Rh41 cells were transfected with 2 μg of CMV-GFP (Clontech) and 200nM of siRNA using the Invitrogen Neon Transfection System (Voltage 1050V ...
-
bioRxiv - Genetics 2021Quote: The PCR reaction mixture contained 0.05 μl Ex Taq polymerase (5 U/μl, TAKARA), 1μl 10X Ex Taq Buffer (20 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μL of Yeastmaker Carrier DNA (10 mg/mL, #630440, Takara Bio, Kusatsu, Japan), 1 μL of genome-editing plasmid (200–600 ng) ...
-
bioRxiv - Genomics 2020Quote: ... and 72°C for 5 s) on the PCR Thermal Cycler Dice (Takara Bio) using PrimeSTAR MAX DNA polymerase (Takara Bio) ...
-
bioRxiv - Biochemistry 2020Quote: ... Clarified supernatants were purified using a 5 mL Cobalt or Nickel affinity column (Takara). Purified protein was concentrated ...
-
bioRxiv - Cancer Biology 2020Quote: ... or SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA, Figure 5) according to the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... milk 5%) and incubated with a 2000-fold dilution of anti-GFP (JL8; Clontech), anti-RGA (Agrisera) ...
-
bioRxiv - Neuroscience 2021Quote: A floxed stop cassette (69) was inserted 5’ of the tTA2 coding sequence (Clontech) into the plasmid pcDNA3 (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were harvested 5 days post-transfection and passed over Cobalt-TALON resin (Takara) followed by size exclusion chromatography on Superdex 200 Increase 10/300 GL (GE Healthcare ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...