Labshake search
Citations for Takara Bio :
201 - 250 of 602 citations for Human CLEC4M L SIGN His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... One µg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Clover-(His)6-LactC2 was purified from the supernatant with 3mL of the TALON superflow metal affinity resin (Clontech, CA). The resin was washed with 5 mM imidazole in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were washed twice with Pulldown Buffer and ran on SDS-PAGE followed by western blotting (anti-His Clontech 631212).
-
bioRxiv - Plant Biology 2021Quote: ... Ten colonies picked up with a tooth pick were diluted in 1ml 0.9%NaCl and spotted onto SD/-Ade/-His/-Leu/-Trp medium (Clontech, 630428) with or without a-X-Gal (GoldBio ...
-
bioRxiv - Biochemistry 2022Quote: ... The induction of His-and GST-fusion proteins and their subsequent purification using TALON® Metal Affinity Resin (Clontech Laboratories) and Glutathione SepharoseTM 4 Fast Flow beads (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Microbiology 2022Quote: ... One μg of total RNA was used as input for SMARTer Stranded Total RNA Sample Prep Kit-HI Mammalian (Clontech). Sequencing was performed on the NextSeq500 instrument (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... medium and 10-fold dilutions of these cultures were dropped on SD control (−2) and selective medium additionally lacking His (−3) (Clontech). Empty vectors were used as negative controls ...
-
bioRxiv - Physiology 2022Quote: ... and cDNA libraries were generated using SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Takara Bio, Inc., Kusatsu, Japan). Libraries were high-output single-end sequenced on a NextSeq500 instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA3.4 expression vector containing the sequence that encodes the His-tagged extracellular domain of the spike protein was transfected into Expi293 cells and the His-tagged spike protein produced in the culture supernatants was then purified with a Talon resin (Clontech).
-
bioRxiv - Biochemistry 2022Quote: A DNA fragment coding C-terminally His-tagged Gtsf1 or Gtsf1L was amplified by PCR and cloned into pCold vector (Takara) by In-fusion cloning kit (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... His-tagged AmiC was isolated from the protein sample using a TALON® metal affinity resin (Takara Bio USA, Inc) as previously described (51 ...
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was obtained by centrifugation of the cell lysate at 10,000 g for 30 minutes and applied into the His TALON™ gravity column (Clontech). The columns were washed to remove the non-target proteins ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting amplicons were cloned into pKTS786 (a pcDNA 3.1/V5-His based vector) that had been linearized with BstX1 with an In-Fusion HD cloning kit (Takara 638909) (76) ...
-
bioRxiv - Plant Biology 2023Quote: ... and the input and pull-down prey proteins were detected by immunoblot using anti-His (M201, Takara, 1:3000 dilution) and anti-GST (G018 ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Molecular Biology 2020Quote: ... To generate the light-inducible clustering constructs, the CRY2olig sequence (Taslimi et al., 2014a) was inserted with a c-terminal mCherry tag (Clontech) into pGEMHE to generate pGEMHE-CRY2olig-mCherry ...
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing a c-terminal Influenza Hemagglutinin (HA) reporter tag was cloned into the backbone pLX317-empty using the In-Fusion cloning kit (Clontech). The backbone was cut with BamHI and EcoRI.
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Biochemistry 2020Quote: ... Full-length EGFP fused N-terminally to a nuclear localization signal (NLS) and C-terminally to a Myc-tag was expressed from pCMV (Clontech).
-
bioRxiv - Microbiology 2019Quote: ... mIRE1-wt was PCR-amplified (without a myc tag) from pcDNA3-mIRE1-3xmyc (Stahl et al, 2013) and subcloned in pMSCVhyg (Clontech) using BglII and HpaI sites ...
-
bioRxiv - Cell Biology 2022Quote: 3’ NotI-STOP-ORD5_Rv GCACA GCGGCCGC ctactgtggccggagggctggtcg For the HA-ORP5 cloning the PCR product (carrying the HA tag at the N-terminus of ORP5) was ligated between AgeI and XhoI in the pEGFP-C1 vector (Clontech) and replacing the GFP- with the HA-tag ...
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Genomics 2019Quote: ... we prepared whole genome sequencing libraries using 1 ng input from healthy volunteer samples using ThruPLEX Tag-seq (Takara Bio). We performed sequencing on HiSeq 4000 (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Developmental Biology 2020Quote: ... This allowed the HA tags to be replaced with GFP (amplified with primers including the AatII sites from pEGFP-N1 (Clontech). Forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... and tandem repeat Sgo_R3-4 (aa 621– 789) were cloned downstream of a hexahistidine tag and 3C protease specific linker by the In-fusion method (Clontech; primer sequences listed in Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... siRNA resistant WRN transgenes containing a C-terminal 3xFLAG tag (designated WRNr) were synthesized and inserted into the lentiviral pLVX-IRES-puro plasmid vector (ClonTech) at GenScript ...