Labshake search
Citations for Takara Bio :
451 - 500 of 602 citations for Human CLEC4M L SIGN His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Aurora A and TPX2 were amplified from human testis cDNA (Marathon cDNA, Takara Bio Inc.) using Pfu polymerase (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... and SOX4 were amplified from a reverse transcript of Human Fetal Brain Total RNA (Takara) by high-fidelity PCR using Phusion DNA Polymerases (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Developmental Biology 2023Quote: ... The ORF of human KIF23 was cloned within pCAX vector using In-Fusion system (TaKaRa). The disease associated c.755T>A mutation was introduced to human KIF23 cDNA by the PCR-based mutagenesis as described (Xia et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... gDNA from all cells were isolated using the Machery Nagel L Midi NucleoSpin Blood Kit (Clontech, 740954.20). Modifications to the manufacturer’s instructions were added as follows ...
-
bioRxiv - Bioengineering 2019Quote: The promoter of the HSPA6 gene (Uniprot P17066) was amplified from human genomic DNA (Clontech #636401) from −1231 bp to +119 bp relative to the transcriptional start site ...
-
bioRxiv - Biochemistry 2019Quote: Human LRAT cDNA was synthesized and cloned into a pcDNA3.1(+) vector (Clontech, Palo Alto, California, USA) by a third party (GeneArt ...
-
bioRxiv - Cancer Biology 2019Quote: ... The human patient PDX cell lines were maintained in RPMI-1640 medium containing 10% FBS (Clontech). KRAS mutation status ...
-
bioRxiv - Biochemistry 2020Quote: ... Human IFITM3 cDNA was purchased from Open Biosystems and PCR cloned into pCMV-HA vector (Clontech). All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio) for the cells following manufacturer protocol.
-
bioRxiv - Genomics 2022Quote: ... 100 ng of polyA selected RNA from the human lung carcinoma cell line A549 (Takara #636141) was used as input ...
-
bioRxiv - Physiology 2022Quote: ... the cDNAs of full length human GCNA or IDR hGCNA were cloned into pEGFP-C1 (Clontech) between BglII and SalI sites ...
-
bioRxiv - Genetics 2019Quote: Regions orthologous to human placental igDMR were PCR-amplified with TaKaRa EX Taq HS (TaKaRa Bio) with primers specific for chimpanzee and rhesus macaque CGIs (Supplementary Table 4) ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for C-terminal GFP-tagged human RHBDL4 were generated by subcloning into pEGFP-N1 (Clontech). For generating point mutants ...
-
bioRxiv - Cell Biology 2020Quote: Human sparc cDNA clone was described by us before 29 and subcloned into pShuttle vector (Clontech). Adenovirus expressing human SPARC was constructed using Adeno-X expression system (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... OCIAD1 was initially cloned from human cDNA into a pAcGFP-N1 vector (Clontech, Mountain View, CA). The GFP1-10 vectors were cloned by Gibson assembly into a FUGW lentiviral backbone (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... the cDNA encoding human Wt-syn was introduced into a vector from Clontech (Mountain View, CA) containing the mRFP sequence ...
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Biophysics 2023Quote: Human cell lines used in this study include U2OS and Lenti-X 293T (Takara Bio USA). Lenti-X 293T cells were only used for virus production ...
-
bioRxiv - Immunology 2023Quote: ... The human J chain was replaced with the DsRed2 gene of pDsRedN1 (Takara Bio, Shiga, Japan). The pIgR gene was inserted into the pEF-Myc-His vector (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cDNA was amplified by a polymerase chain reaction from a human brain cDNA library (Clontech, CA) using an appropriate primer pair ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid GFP-GT198 contained full-length human GT198 in a pEGFP-C3 vector (Clontech, 6082-1). HeLa cells transfected with GFP-GT198 (green ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA directed against human MAGI1 and AMOTL2 were constructed and cloned in the pSIREN-RetroQ vector (TaKaRa) according to the manufacturer’s conditions between BamHI and EcoRI cloning sites as previously described for other genes 75 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated from a human lung poly-A+ RNA (cat. 636105, Takara Bio, Kusatsu, Shiga, Japan) using a cDNA library construction kit (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: The pIRES-DsRed2 and pDsRed2-C1 vectors used to express various human aquaporin constructs were from Clontech. The human pCMV6-AC-AQP9-GFP expression vector was from Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pTT3-based IgG expression vectors with human constant regions (84) using In-Fusion cloning (Clontech), expressed in 293 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Human KCNQ2 cDNA (GenBank accession number NM_172108) in pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA) was used as template for in vitro mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Cancer Biology 2019Quote: ... A full-length Myc tagged cDNA expressing human NEK9 (NM_001329237.1) was subcloned into the pVLX-Tight-Puro vector (Clontech). The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene ...
-
bioRxiv - Cell Biology 2022Quote: ... a DNA fragment was PCR-amplified from human genomic DNA using Tks Gflex DNA Polymerase (#R060A, Takara Bio) and the primers listed in Table S1 ...
-
bioRxiv - Immunology 2023Quote: Wt or mutated human (h)ALPK1 cDNA constructs were cloned into the pCMV-myc plasmid (Takara Bio Inc) and were all siRNA resistant against the hALPK1 siRNA (s37074 ...
-
bioRxiv - Cell Biology 2023Quote: ... Full-length human CLUH and mouse Cluh coding sequences cDNA were cloned in pcDNA3 and pmCherry-N1 (Clontech), respectively ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Cell Biology 2019Quote: ... First-strand cDNA was synthesized from l μg of RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (catalogue No. RR047A, TaKaRa). qPCR was performed in triplicate in 20-μl reactions containing SYBR Premix Ex Taq II (catalogue No ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of each common amplicon were pooled and gel purified from a 1.5% agarose gel (Nucleospin clean-up, Takara Bio), eluting in 35 μl 10 mM Tris-HCl ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Genetics 2019Quote: ... About 1 μL of viral RNAs were used as template to synthesize cDNAs with PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Absolute quantitative real-time PCR assay was performed with SYBR green I (TOYOBO ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa (cTT20.1166, gift from Kara L. McKinley and Iain Cheeseman) and Lenti-X HEK293T cells (Takara Bio, used for lentivirus production) were cultured in DMEM (Gibco ...