Labshake search
Citations for Takara Bio :
2401 - 2450 of 4629 citations for Uridine Triphosphate UTP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... First-strand cDNA was synthesized using the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TAKARA, Kusatsu, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was extracted from collected plant leaves using TaKaRa MiniBEST Universal RNA Extraction Kit (Takara, Japan). 1 ug of total RNA was reverse-transcribed into cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from three-week subcultured callus using an RNAiso plus Kit (TaKaRa, http://www.takara.com.cn) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplified cDNA libraries were prepared using Takara’s SMART-seq v4 Ultra Low Input RNA Kit (Takara 634888) and sequenced on Illumina’s NovaSeq 6000 platform ...
-
bioRxiv - Neuroscience 2020Quote: RNA-Seq libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio USA ...
-
bioRxiv - Neuroscience 2020Quote: ... Physical viral titer was determined using either Lenti-X qRT-PCR Titration Kit (Takara, Mountain View, CA) or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... it was inserted into the pUAST attB vector using an In-Fusion® HD Cloning Kit (Clontech). The primer sequences used for the PCR are as follows ...
-
bioRxiv - Microbiology 2020Quote: ... or (ii) the SMARTer Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian libraries (Takara Bio USA) for ALG_1 and ALG_3 (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... The approximate titer of lentivirus was evaluated using a lentiviral titration kit (Lenti-X GoStix Plus; ClonTech). The lentiviral medium was transferred to 50 mL centrifuge tubes ...
-
bioRxiv - Microbiology 2021Quote: ... which was prepared with the ThruPLEX DNA-seq Kit (Takara Bio USA, Inc., Mountain View, CA, USA). 2 × 250 bp sequencing was performed using the Illumina HiSeq 2500 V4 platform ...
-
bioRxiv - Physiology 2021Quote: ... 1 μg RNA was used to synthesize first strand of cDNA using PrimeScriptTM RT-PCR Kit (TaKaRa). qPCR was conducted using PrimeScriptTMRT Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2021Quote: ... the RNA was converted into cDNA using PrimeScript™ II 1st Strand cDNA Synthesis Kit (TAKARA, 6210A) following the instruction in the manual ...
-
bioRxiv - Plant Biology 2021Quote: ... Applied Biosystem StepOne real-time PCR system and SYBR Premix Ex Taq II kit (Takara, Dalian, China) were used for the qRT-PCR detection ...
-
bioRxiv - Molecular Biology 2021Quote: ... In-Fusion cloning was performed using the In-Fusion® HD Cloning Plus Kit (Takara Bio, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... 1 μg of total RNA was used to synthesize cDNA with PrimeScript RT reagent kit (RR047A, Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Two PCR products were inserted into the vector backbone using In-Fusion HD Cloning Kit (Takara Bio) to generate pLJM1-LTR-FT ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The library was generated by using the SMARTer Stranded Total RNA Sample Prep Kit - HI Mammalian (Clontech) with 1 μg RNA as input ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were constructed using SMARTer Stranded Total RNA-seq Kit v2 – Pico Input Mammalian (Clontech), starting from 5ng total RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... The final pQE-JAK3 construct was used to transfect GC using the Xfect transfection kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using a SYBR Premix Ex TaqTM kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was reverse transcribed to cDNA using the PrimeScript™ RT reagent Kit (TaKaRa, RR037A, Japan). Convergent and divergent primers were used to detect the expression of linear and circular RNA transcripts ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA libraries were prepared using SMART-seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa Bio), which is based on the SMART-seq2 method (Picelli et al. ...
-
bioRxiv - Microbiology 2022Quote: ... the fragments were sequentially ligated into the target vector using the In-Fusion HD Cloning Kit (Clontech). The resulting plasmid sequences were verified by Sanger sequencing (GATC Biotech ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... single-stranded cDNA was generated from RNA using the SMARTer cDNA synthesis kit (Clontech, Palo Alto, CA) with tagged oligo-dT primers that include one of eight 15-bp barcodes to distinguish individual samples (2 species x 2 tissues x 2 biological replicates) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ multiplexed RNA-sequencing was performed with the Takara SMART-Seq v4 3’ DE Kit (Takara 635040) followed by Nextera XT (Illumina FC-131-1024 ...
-
bioRxiv - Genomics 2022Quote: ... CH17-203N23 and CH17-449P15 BACs were extracted by using a NucleoBond Xtra BAC kit (Takara, 740436.25). ∼1 μg of BAC DNA was digested with 30 nM of sgRNAs (IDT) ...
-
bioRxiv - Cell Biology 2022Quote: The cDNA synthesis was done using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Clontech) and the library was prepared using Nextera XT DNA Library Prep kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets was collected and isolated for total RNA with MiniBEST Universal RNA Extraction Kit (Takara, #9767). Total RNA (1 μg ...
-
bioRxiv - Plant Biology 2021Quote: ... gDNA removal and first-strand cDNA synthesis were conducted by PrimeScriptTM RT reagent Kit (Takara, Beijing, China) with 0.5 μg total RNA for each sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2-Pico Input (634412, Takara). A total of 32 samples were sequenced for 50-bp single-end reads across 4 lanes on an Illumina HiSeq 2500 by the University of Michigan Advanced Genomics Core ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed with the Clontech SMARTSeq v4 3’ DE kit (Takara Bio USA, Inc. 635040) kit ...
-
bioRxiv - Neuroscience 2020Quote: ... The knock-in plasmid was constructed by using In-Fusion HD Cloning kit (Takara Bio USA #639650) or NEBuilder HiFi DNA Assembly kit (New England Biolabs #M5520 ...
-
bioRxiv - Molecular Biology 2020Quote: The cDNA synthesis kits and SYBR Green Master Mix were obtained from Clontech (Mountain View, CA, USA). Dexamethasone and Granzyme B inhibitor Z-AAD-CMKwere purchased from Sigma-Aldrich (St ...
-
bioRxiv - Molecular Biology 2020Quote: DNA ligation was performed using standard ligation techniques (Takara DNA Ligation kit ver. 2.1; Takara, Otsu, Japan). For transformation ...
-
bioRxiv - Neuroscience 2020Quote: ... spectrophotometer followed by reverse transcription reaction to produce cDNA using PrimeScript RT Reagent Kit (Takara, Clonetech, Japan). Specific primers against the genes of interest (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription was performed with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat no. RR047A) and qRT-PCR was performed on StepOne Plus Real-time PCR system (Applied Biosystem ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription of RNAs were carried out using PrimeScript II 1st strand cDNA Kit™ (Takara, Japan). The coding sequences of DGAT1s were amplified by a high-fidelity KOD-Plus-Neo polymerase (Toyobo ...
-
bioRxiv - Biochemistry 2021Quote: pRM823 (pUC118-bamA) was constructed by in vitro recombination using In-Fusion HD cloning kit (Takara Bio) of a EcoRI-BamHI fragment from pUC118 and a bamA fragment prepared by PCR amplification from the genome of MC4100 using a pair of primers ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized from equivalent total RNA using PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara #634894) according to the manufacturer’s instructions except that 10 µL instead of 9 µL was used to optimize for low RNA input ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from PSCs and vesicles by Mini BEST Universal RNA Extraction Kit (Takara, Japan), as previously described (66) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Bioengineering 2021Quote: ... an endotoxin-free plasmid midiprep DNA purification took place using NucleoBond Xtra Midi EF kit (Takara Bio) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Systems Biology 2022Quote: ... cDNA was generated using the SMART-Seq V4 Ultra Low RNA Kit (Takara Bio, Mountain View, CA). After 14 cycles of library amplification ...
-
bioRxiv - Immunology 2022Quote: ... RNA (1 ng) was amplified using SMARTer library Ultra Low cDNA v4 kit (Takara Bio, Mountainview, CA). Sequencing cDNA libraries were preparing using a NexteraXT DNA library prep kit (Illumina ...