Labshake search
Citations for Takara Bio :
2301 - 2350 of 4629 citations for Uridine Triphosphate UTP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription of RNA to cDNA was performed using the PrimeScript RT Reagent kit (RR037A, Takara). Quantitative RT-PCR was then performed on the cDNA using TB Green Premix Ex Taq II (RR820A ...
-
bioRxiv - Developmental Biology 2023Quote: ... and reverse transcribed to synthesize cDNA using a PrimeScript RT Master Mix reverse transcription kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted from Col-0 and mutant seedlings using an RNAiso Plus kit (Takara). Complementary DNAs (cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus (AAV) cell-lysates were produced using the AAVpro Purification Kit (All Serotypes) (Takara) with slight modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Developmental Biology 2024Quote: ... libraries were prepared by the iGE3 Genomic Platform using the SMART-Seq v4 kit (Clontech, 634893) for the reverse transcription and cDNA amplification ...
-
bioRxiv - Genomics 2023Quote: ... Eluted DNA was prepared as sequencing libraries with the ThruPLEX-FD Prep Kit (Takara bio, # R400675). Libraries were sequenced with 150-BP PE on an Illumina HiSeq 2500 Sequencing platform at Novogene.
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... samples were prepared according to the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... banked cell pellets were rapidly thawed and processed using the Nucleospin® Blood XL kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription of RNA was performed using PrimeScriptTM reagent Kit (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids for producing XccOpgD mutants were constructed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... site-directed mutagenesis of gPLT2 was performed using the in-fusion HD cloning Kit (Takara Bio). The further reactions followed the in-fusion HD cloning Kit manual (Takara Bio) ...
-
bioRxiv - Plant Biology 2023Quote: Yeast one-hybrid assays were performed using the Matchmaker Gold Yeast One-Hybrid System Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2024Quote: ... following the manufacturer’s instructions and used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa).The sequences of FaMyo5 motor domains were amplified from the cDNAs of all the F ...
-
bioRxiv - Plant Biology 2024Quote: ... The first-strand cDNA synthesis was performed with the Prime Script RT Master Mix kit (Takara). Quantitative real-time PCR was performed at 60°C using Takyon No ROX SYBR 2X MasterMix blue dTTP (Eurogentec ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were prepared using SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411). Single-end sequencing was performed on the Ilumina NovaSeq platform with a sequencing depth of 80 million reads and a read length of 100 bp.
-
bioRxiv - Physiology 2023Quote: ... we synthesized the first-strand cDNA using the PrimeScript 1st-strand cDNA synthesis kit (TaKaRa, Japan). The qRT-PCR was conducted in a 20μl reaction volume employing SYBER Green Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2023Quote: ... Site-directed mutagenesis at the CESA1 sequence was performed using the infusion cloning kit from Takara Bio ...
-
bioRxiv - Neuroscience 2024Quote: ... The cDNA was obtained by using the PrimeScript RT Reagent Perfect Real Time kit (Takara, Japan). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... was reverse-transcribed using a PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and one μg of RNA was reverse transcribed using a cDNA Reverse Transcription Kit (RR037A, Takara). Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A ...
-
bioRxiv - Molecular Biology 2024Quote: ... and plasmid DNA was isolated using NucleoSpin® Plasmid (NoLid) kit for miniprep (740499.250; Takara Bio) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A, Takara) on a Light Cycler Real-Time PCR System (480II ...
-
bioRxiv - Microbiology 2024Quote: ... after which DNA was extracted using the NucleoSpin Microbial DNA kit (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry tsa1 mutant alleles were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... coli total RNA using SMARTer smRNA-Seq Kit for Illumina (Cat# 635029, Takara Bio, Shiga, Japan). Libraries were quality-checked on the Fragment Analyzer (Agilent Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was used for library preparation with SMARTer® StrandedTotal RNA-Seq Kit v3 (Takara Bio) with rRNA removal and sequenced on Illumina Novaseq 6000(50 bp paired-end mode ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rapid amplification of cDNA ends (RACE) was performed using the SMART RACE cDNA Amplification Kit (Clontech). For LhGAP3 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). The projection-specific neurons was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). The projection-specific neurons was aspirated into a pipette and then expelled into a PCR sterile tube containing 1 µl oligo-dT Primer and 1 µl dNTP mixture ...
-
bioRxiv - Neuroscience 2023Quote: mRNA was reversely transcribed to cDNA by PrimeScriptTMⅡ1st Strand cDNA Synthesis Kit (Takara-Clontech, Kyoto, Japan). At the end of electrophysiological recordings ...
-
bioRxiv - Microbiology 2024Quote: ... and 20 or 25 uL were assayed using either the Great EscAPe SeAP kit (Takara/Clontech) or the Phospha-Light System (Applied Biosystems).
-
bioRxiv - Microbiology 2024Quote: ... and 20 or 25 uL were assayed using either the Great EscAPe SeAP kit (Takara/Clontech) or the Phospha-Light System (Applied Biosystems).
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized from 100 ng of RNA using a PrimeScript 1st strand cDNA Synthesis Kit (Takara). The resulting cDNA was quantified with a LightCycler 480 (Roche ...
-
bioRxiv - Plant Biology 2019Quote: cDNA was synthesized with oligo(dT) primers using PrimeScript™ 1st strand cDNA synthesis kit (Takara, Japan). Quantitative RT-PCR analysis was performed on an Agilent Real-Time qPCR apparatus (Mx3000P system ...
-
bioRxiv - Biophysics 2021Quote: ... The first-strand cDNA was synthesized using a PrimeScript® RT reagent Kit (Takara, Otsu, Shiga, Japan). The PlMYB308 gene was PCR-amplified using specific primers (Table S6) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was isolated from cells using the NucleoSpin RNA Plus kit of Clontech Laboratories (Takara Bio Company). cDNA was constructed using the In-Fusion SMARTer Directional cDNA Library Construction kit of Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: ... QPCR reactions were performed according to the manufacturer’s instructions using SYBR® Premix Ex Taq kit (TaKaRa). All reactions were performed in triplicates ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from cells and quantified using RNA Isolation Reagent kit (9109, Takara, Tokyo, Japan). cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was extracted and cDNA was prepared using the SMARTer v3.0 or v4.0 cDNA synthesis kit (Clontech). RNA-Seq was performed on an Illumina Nextseq 500 machine ...