Labshake search
Citations for Takara Bio :
151 - 200 of 815 citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid pGEX-6p-3-lev-11A was generated by seamlessly cloning lev-11A cDNA into pGEX-6p-3 by In-Fusion cloning (Takara, Shiga, Japan). For expression of mCherry-tagged LEV-11 isoforms in body-wall muscle ...
-
bioRxiv - Microbiology 2024Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Immunology 2024Quote: Mouse IL-27 p28 3′UTR plasmid was cloned by inserting p28 3′UTR into MCS of the pEGFP-C1 vector (Clontech, California US) between XhoI and KpnI sites ...
-
bioRxiv - Immunology 2021Quote: ... and 3 U Recombinant RNase Inhibitor (Takara, Cat#2313A), sealed and immediately frozen on dry ice ...
-
bioRxiv - Microbiology 2023Quote: ... to amplify the 3’ end and CloneAmp (Takara Bio) for amplification of the 5’ end.
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 21 bp barcodes were amplified with 5’-GGGATCACTCTCGGCATGG-3’ forward and 5’-CTGATCAGCGAGCTCTAGGAA-3’ reverse primers and PrimeSTAR GXL DNA polymerase (Takara Bio, Shiga, Japan). They were then sequenced with NextSeq 500 1×150 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... was used to determine 5’ and 3’ terminal nucleotide sequences of PcAEV4 and PcAEV5 with the SMARTer® RACE 5’/3’ Kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Microbiology 2022Quote: ... monoclonal antibody (Clontech) and peroxidase-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Cell Biology 2024Quote: The following commercial antibodies were used: GFP-antibody (JL-8, Takara Bio) dilution 1/1000 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-GAPDH antibody (Clontech) at a 1/2500 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubation with the primary antibody (polyclonal rabbit anti-dsRed antibody, 632496, Clontech, dilution 1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... the primary antibody was anti-dsRed antibody (dilution 1:1000, Clontech, Cat #632496), and the second antibody was goat anti-rabbit conjugated with Cy3 (Jackson ImmunoResearch ...