Labshake search
Citations for Takara Bio :
151 - 200 of 776 citations for Adenovirus Type 5 Particles CMV β galatosidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... the purified DNA fragment of the MyoD gene was cloned into a pAAV-CMV vector using the In-Fusion Cloning HD Kit (Takara Bio). The DNA fragment corresponding to the 300 bp 5′ upstream region (−250 to +50 ...
-
bioRxiv - Immunology 2019Quote: ... and the pool of viral particles was concentrated using Lenti-X concentrator (Clontech Laboratories; cat. no. 631231). The titer of the GXMR-CAR viral particles was determined using HEK-293FT cells ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... Lysing of cells and particle purification were carried out using AAVpro® Purification Kit (All Serotypes, TAKARA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... AAVs particles were then purify from AAV-producing cells using AAVpro Purification Kit Maxi (Takara, Cat. #6666).
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcriptase-containing pseudoviral particles and recombinant reverse transcriptase standard of known concentrations (TAKARA, Cat. No. RR047A) were 10-timed diluted with nuclease-free water (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... viral particles were concentrated 20-fold to 400Lμl using Lenti-X Concentrator (Clontech, #631231, Mountain View, CA), and 100Lμl of concentrated virus was used to infect cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... CT-2AZsGreen cells were generated using lentiviral particles derived from a pLVX-ZsGreen1C1 vector (Takara Bio #632566). All cell lines were grown in DMEM high glucose with 10% FBS (Gibco #16140-071 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral particles were collected 72 hours after transfection and concentrated by using Lenti-X Concentrator (631231, Takara). After transduction ...
-
bioRxiv - Biochemistry 2023Quote: ... The virus particles were further concentrated at 10X in volume using Lenti-X-concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... The SOX2 PCR product was purified and inserted into CMV-t2a-GFP using the In-Fusion HD cloning kit (Takara Bio USA) and transformed into Stellar Competent Cells (Takara Bio USA) ...
-
bioRxiv - Neuroscience 2021Quote: Auto-TDP-43-HA was then packaged into lentivirus (LV) via co-transfection with CMV-Gag-Pol (Harvard #dR8.91) and pVSV-G (Clontech, part of #631530) plasmids into production HEK293T cells adapted to grow in serum-free conditions (OHN media ...
-
bioRxiv - Immunology 2022Quote: ... (both kind gifts from Pilar Gonzalo and Joaquin Teixidó (Bartolomé et al. 2009)) were cloned into the lentiviral backbone pLVX-CMV-IRES-zsGreen1 (Takara/Clontech #632187) by Gibson assembly (Gibson et al ...
-
bioRxiv - Genomics 2022Quote: ... These guides were individually cloned into pAAV-U6-sasgRNA-CMV-mCherry-WPREpA (92) at the BstXI and XhoI restriction enzyme sites using the In-Fusion (Takara Bio, 638910) cloning methods as described in (92) ...
-
bioRxiv - Neuroscience 2021Quote: ... cells and medium were collected and AAV particles were purified by AAVpro Purification Kit (Takara Bio; Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... GRV particles were produced by transient transfection of Phoenix GP cells and concentrated using Retro-X concentrator (Takara). Sorted HSPC were pre-expanded for two days ...
-
bioRxiv - Neuroscience 2022Quote: ... Media containing viral particles was sterile-filtered and concentrated using the Lenti-X™ Concentrator (Takara Bio, 631231), according to manufacturer instructions.
-
bioRxiv - Cell Biology 2023Quote: ... the media was collected and viral particles were concentrated using Lenti-X™ Concentrator (Takara Bio Inc., 631231). For transduction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and wild type etoll-9 was cloned in pGBKT7-BD vector (Clontech). Each mutant etoll-AD was transformed in Y187 strain followed by selection on synthetic defined (SD ...
-
bioRxiv - Genomics 2019Quote: ... Wild-type sequences were generated by PCR using human genomic DNA (Clontech) as a template ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plasma Gla-type osteocalcin was analyzed by enzyme immunoassay (#MK111, Takara, Japan). The absorbance was read at 450 nm using a microplate reader (Bio-Tek ...
-
bioRxiv - Microbiology 2020Quote: The lentivirus-based expression plasmids were generated with a pLOV-CMV-GFP vector (Neuron Biotech, China) using In-Fusion HD Cloning kits (Clontech Laboratories, Inc., USA), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... The rat IGF1 coding sequence was then inserted into the linearized scAAV-CMV plasmid using In-Fusion cloning (Takara Bio; Cat. No. 639650). The resulting plasmids for scAAV-CMV-GFP and scAAV-CMV-IGF1 were packaged using AAV2/9 serotype by Vector Biolabs (Malvern ...
-
bioRxiv - Microbiology 2023Quote: The FLAG-vPOL construct was generated by amplifying the MHV68 vPOL from the recombinant MHV68 M3-Luc bacterial artificial chromosome (BAC) (39) with PCR followed by insertion in the p3xFLAG-Myc-CMV-24 vector (CloneTech Takara Biotech, Mountainview, CA) at the EcoRI and SalI restriction sites ...
-
bioRxiv - Neuroscience 2024Quote: ... The untagged version was made by cloning the RBP2 cDNA from this plasmid and replacing RIBEYE-GFP in the pAAV-CMV-HBA-RIBEYE-GFP-WPRE plasmid by in-fusion cloning (Takara Bio USA, Inc.).
-
bioRxiv - Cell Biology 2019Quote: ... and 4 μg of pCMV-β-galactosidase (Clontech Laboratories, Inc., CA, USA) using electroporation according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a luminometric β-galactosidase detection kit (Takara Bio, Palo Alto, CA) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Immunology 2019Quote: ... Media containing viral particles was collected 48 hr post-transfection and titer was assayed with Lenti-X GoStix (Clontech). Viral supernatant was centrifuged at 3,000 r.c.f ...
-
bioRxiv - Cell Biology 2022Quote: ... All lentiviral particles were produced in Lenti-X 293T cells using the Lenti-X HTS Packaging System (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was filtered through a 0.45μm PES filter and the viral particles concentrated 100 times using Lenti-X™ Concentrator (Takara) before storage at −80 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmid DNA used to generate lentiviral particles were transfected into HEK293 cells using LentiX single-shot VSV-G (Takara) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... Supernatant containing viral particles was harvested after 2 and 3 days and concentrated 100x using Lenti-X concentrator (Takara) following manufacturers instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... NEK9 lentiviral particles for each construct were harvested from transfected 293T packaging cells using the Lenti-X(tm) HTX Packaging System (Clontech), transduced into U2OS parental cells and selected in fresh media supplemented with 2 mg/ml of G418 and 1 µg/ml puromycin over several days ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Retrovirus supernatant or medium containing virus particles was harvested at day 2 post transfection and concentrated by Retro-Concentrator (Clontech) solution ...
-
bioRxiv - Cell Biology 2022Quote: ... VSV-G pseudotyped retroviral particles encoding constructs of choice were prepared using standard protocols using GP2-293 packaging cells (Clontech). Viral supernatants were collected and used to infect target cells by centrifugal inoculation (spinoculation) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human melanoma cell lines and Hema-LP were overlaid with viral particles diluted in DMEM/1x Glutamax with 10% TET System Approved FBS (Clontech) supplemented with 5 μg/ml polybrene (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2019Quote: ... and lentiviral Tre3G-Cas9 and Tet3G particles were produced in HEK293T cells using the Lenti-X HT packaging system (Clontech). Transduced cells were selected with 10 μg/mL puromycin and 400 μg/mL G418 ...
-
bioRxiv - Cancer Biology 2022Quote: Viral particles were generated by transfecting the lentiviral construct into HEK-293T cells using Lenti-X Packaging Single Shots (Clontech). 48 hours after transfection ...
-
bioRxiv - Immunology 2022Quote: ... Concentrated particles were resuspended in 100% WRN conditioned media and titers were checked using Lenti-XTM GoStixTM Plus (Takara 631280). Only high titer lenti-particles were used to transduce duodenoids ...
-
bioRxiv - Molecular Biology 2023Quote: ... the supernatants of infected cells were collected and infectious virus particles were measured using the Adeno X Rapid Titration Kit (Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HEK293-FT cells were used to prepare lentiviral particles according to the instructions in the Lenti-XTM Lentiviral Expression System Manual (Clontech). Doxycycline-inducible ZDHHC20 expressing HEK293T cells were prepared by transduction of 2.5 X 105 low-passage cells with lentivirus ...
-
bioRxiv - Genomics 2024Quote: ... The cells were infected with prepackaged lentiviral particles (constitutive reporter vector expressing tdTomato fluorescent protein gene driven by EF1a promoter (Takara) at MOI of 20 (Stock ...
-
bioRxiv - Cancer Biology 2024Quote: ... with psPAX2 and pMD2.G viral particles harvested during the 16-72 h window post-transfection were concentrated with Lenti-X (Clontech) and stored at -80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Plant Biology 2021Quote: ... Liquid β-galactosidase assays were performed as described in the Yeast Protocols Handbook (Clontech). A Y2HGold yeast strain containing a bait vector was mated with the Y187 strain containing the pGADT7 vector and selected on SD/-Trp/-Leu media ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-3-3τ and β-actin were designed and synthesized by Takara (Table 1). To run the real-time PCR reaction ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...