Labshake search
Citations for Takara Bio :
1551 - 1600 of 5211 citations for Ceruloplasmin Colorimetric Activity Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected using the CalPhos mammalian transfection kit (TaKaRa Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... All PCR products were inserted using the In-Fusion cloning kit (Clontech) into the pBMDEL which had been linearized with BfuAI ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Eraser (TAKARA). PCR reactions were prepared using FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All cloning procedures were performed using the in-fusion cloning kit (Clontech).
-
bioRxiv - Genomics 2019Quote: ... Reverse transcription was performed with a PrimeScript RT-PCR Kit (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: ... The RNA was reverse-transcribed with PrimeScript™ RT reagent Kit (Takara) and PCR analyzed with primers chd-RT-F and chd-RT-R (Table 1) ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated using the In-Fusion® HD cloning kit (Takara Bio) according to manufacturer’s instructions or were purchased (Addgene) ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription was performed with the PrimeScript RT reagent kit (RR037A, TaKaRa).
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Genomics 2020Quote: ... and reverse transcribed using PrimeScriptⅡ 1st strand cDNA Synthesis Kit (TaKaRa, Japan). The sequence of the LFY gene was amplified by PCR in 50-µL reaction mixture by using TaKaRa Ex Taq Hot Start Version (TaKaRa Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAseq library was prepared by DNA SMART ChIP Seq Kit (TAKARA #101617). RNA Sequencing was performed on Illumina NextSeq 500 desktop Next Generation Sequencing (NGS ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified sequences were inserted using InFusion (InFusion HD Cloning kit, Clontech). Plasmid constructs were injected into one-cell zygotes and integrated into the genome via Ac-mediated recombination ...
-
bioRxiv - Neuroscience 2020Quote: ... The transgene plasmid was generated using the InFusion HD Kit (Clontech, 638910) and the NucleoBond Xtra Midi EF Kit (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA sequencing libraries were prepared using a SmartSeq HT kit (Takara Bio) and Illumina Nextera XT kit (Illumina Inc.) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... and inserted into the pFastBac vector using In-Fusion kit (TaKaRa # 638910). Inserts encoding wild-type or mutant Myo1e fragments (motor domain + IQ motif ...
-
bioRxiv - Genomics 2021Quote: ... by calcium phosphate transfection with CalPhos™ Mammalian Transfection Kit (Takara, 631312) following the manufacturer’s protocol into HEK293T cells ...
-
bioRxiv - Physiology 2021Quote: ... The PrimeScript RT reagent kit (Takara Bio, Otsu, Japan; cat. no. RR037A) was used to reverse transcribe total RNA (2 μg ...
-
bioRxiv - Bioengineering 2021Quote: ... Libraries were prepared using the Clontech SMARTer Stranded Total RNAseq Kit (Clontech), precleaned ...
-
bioRxiv - Genetics 2021Quote: ... AD-MSCs and iPSCs by using the Genomic DNA Extraction Kit (TaKaRa). PCR was performed by using Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: ... and cDNA was synthesized with the PrimeScript TMRT Master Mix kit (TaKaRa). qRT□PCR reactions were performed in triplicate using Mastercycler ep realplex (Eppendorf ...
-
bioRxiv - Plant Biology 2020Quote: ... and the resulting fragments were ligated using a DNA Ligation kit (Takara). The cDNAs of NPH3SA and NPH3SE within the pENTR vectors were transferred to both pH35GS and pH35YG binary vectors (Yamaguchi et al. ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was synthesized by using SMARTer PCR cDNA Synthesis Kit (Clontech, CA) according to the IsoSeq protocol (Pacific Biosciences ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcriptase was performed using the PrimeScript™ RT-PCR Kit (Takara). mRNA relative levels of SIGLEC1 were measured by two-step quantitative RT-PCR and normalized to GAPDH mRNA expression using the DDCt method ...
-
bioRxiv - Microbiology 2019Quote: ... RNAseq libraries were prepared with the SMARTer Stranded RNA-seq kit (TaKaRa) using 25ng of RNA input and 12 cycles for library amplification ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated following the protocol by the Trizol kit (TAKARA). SYBR Green (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... after purification and used a high-capacity cDNA reverse transcription kit (Takara) to reverse transcribe RNA into first-strand cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was then amplified with the SMARTer Ultra Low RNA kit (Clontech) including ERCC RNA spike-ins (ThermoFisher Scientific# 4456740) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara). Relative expression with respect to control (act2 gene ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... The sequencing libraries were prepared with ThruPLEX DNA-seq Kit (Takara Bio). The resulting libraries were characterized by using the Qubit dsDNA HS Assay Kit and BioAnalyzer 2100 High Sensitivity DNA Kit ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR product was purified using MiniBEST agarose gel DNA extraction kit (TaKaRa). Following DpnI digestion of the template at room temperature overnight ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was reverse transcribed with the prime Script RT reagent kit (Takara). Differential regulation of cellular genes was assessed using TB Green™ Premix Ex Taq™ II (Tli RNase H Plus ...
-
bioRxiv - Biochemistry 2022Quote: ... Library was prepared using SMARTer smRNA-seq Kit for Illumina (Takara, 635029) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... by using PrimeScript™ RT reagent (Perfect Real Time) Kit (TaKaRa, Japan). All PCR amplifications were performed in triplicate ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by cDNA synthesis using SMARTer PCR cDNA synthesis Kit (Takara Bio).
-
bioRxiv - Cancer Biology 2022Quote: ... The ssDNA template was synthesized using GuideIt Long ssDNA kit (Takara #632666) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1μg) was reverse transcribed with PrimeScript RT Reagent Kit (Takara).
-
bioRxiv - Neuroscience 2020Quote: ... according to the manufacturer’s protocol (AAV purification kit, reference 6666 from Takara and reference VPK-140 from Cell Biolabs) ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNA was isolated using an RNA Plus kit (Takara, Qingdao, China), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNA was amplified using a SYBR Green Master Mix Kit (Takara) in real-time PCR detection system.
-
bioRxiv - Plant Biology 2021Quote: ... reverse transcriptions were performed using PrimeScriptTM RT reagent kit (TaKaRa, Ohtsu, Japan). The RT-qPCR analyses were performed using the TransStart Tip Green qPCR SuperMix (TransGen ...
-
bioRxiv - Plant Biology 2021Quote: ... first strand cDNA was synthesized using PrimeScript™ RT reagent Kit (TaKaRa). The qRT-PCR reaction was performed in a 20 μl reaction volume using SYBR green master mix (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... previously digested with NotI using the In-Fusion cloning kit (Takara Bio) giving rise to plasmid psiCHECK2-mMov10-3’UTR (addgene 178905) ...
-
bioRxiv - Neuroscience 2021Quote: Endophilin A2-mCherry was obtained by subcloning (In-Fusion Cloning kit, Clontech) endophilin A2 cDNA into a pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Extracted RNA was reverse transcribed into cDNA using a kit from Takara. qPCR was performed using the SYBR Green I supermix (BioRad ...