Labshake search
Citations for Takara Bio :
1551 - 1600 of 2483 citations for 7 nitro 3 oxido 6 4 phenylpiperazin 1 yl 2 1 3 benzoxadiazol 3 ium since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... PRR14-GFP 1-212 PCR products were sub-cloned into pLVX-TetOne-Puro (Takara Bio, cat# 631847) vector using T7 ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: cDNA was synthesized with 1 μg of total RNA using the Prime ScriptTM RT Reagent Kit (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The following antibodies were used: anti-GFP (JL-8; 1:20, Clontech, Saint-Germain-en-Laye, France), anti-PHB1 (EP2803Y ...
-
bioRxiv - Cell Biology 2024Quote: ... Actin and GAPDH (primers in Table 1) in ovaries by using TB Green syber mix (Takara - RR820A) as per manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× M buffer containing 160 units of NheI (TaKaRa) overnight at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo (Supplementary Table 1) plasmid with the desired mutation was done via In-Fusion technology (Takara). Each pDONR/Zeo Cac1 mutant plasmid was verified by Sanger sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... and a fusion construct containing nucleotides of CPY (1-50) and Atg15ΔN35 was generated by ligation (Clontech). To generate pRS426-ATG15-3xFLAG (TPL003) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated with primary goat anti-dsRED (1:1000, Takara Bio, Cat# 632496, RRID: AB_10013483), goat anti-ChAT (1:400 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the PimeScript RT-PCR kit (TAKARA) and analyzed by qPCR on LightCycler96 system (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng total RNA was used for SMART-Seq HT PLUS (Takara Bio USA, Inc. Cat # R400748) following manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: Primary antibodies used for imaging include Living Colors anti-DsRed Rabbit Polyclonal Pan Antibody (1:500; TaKaRa), Chicken Polyclonal anti-GFP (1:300 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA (1 μg) was reverse transcribed with the PrimeScript™RT Reagent Kit (Takara Bio Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA (1 μg) was reverse transcribed into cDNA using PrimeScript RT reagent kit (Takara Bio, Japan), and expression was quantified using the TB Green® Premix Ex Taq™ II (Takara) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resin was washed twice by incubating it with 1 mL equilibration buffer for 10 minutes (Takara), centrifuging the resin (700xg for 5 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cDNA was synthesized from 1 μg RNA using PrimeScriptTM RT Master Mix kit (Takara, Cat#RR036A) following the manufacturer’s protocols ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was incubated overnight with 1 mL of Talon (immobilized metal affinity chromatography, IMAC) resin (Takara) in the presence of 10 mM imidazole ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Genetics 2024Quote: ... 1–1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, CA). For non-cleavable INF2 ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-RFP antibodies (1/1000, RT, overnight, rabbit anti-DsRed, 632496, Takara Bio USA, Madison, WI), followed by Alexa-488 (1/100 ...
-
bioRxiv - Bioengineering 2024Quote: ... Transfer clarified supernatant to fresh container and combine 1 volume of Lenti-X concentrator (TaKaRa; Cat.no: 631232) to 3 volumes of clarified supernatant ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 1 μg of extracted RNA per sample using the SMARTScribe reverse transcriptase (Clontech) and dT primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG T30VN) ...
-
bioRxiv - Developmental Biology 2021Quote: ... filtered and concentrated by Lenti-X Concentrator (Clontech, PT4421-2) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 20ul mixed concentrations of 2 × ExTaq buffer (Takara, Japan), 0.8ul of each forward and reverse primer (10uM) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 μg of pEGFP-C1 (Takara Bio, Shiga, Japan), together with 0.5 μg of expression plasmid for bcl-xl ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (NbCycB2proE ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (Nbwo-G1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... reactions were performed using the Advantage 2 Polymerase Mix (Clontech) using the primers (Merck ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification was performed using Advantage GC 2 PCR kit (Clontech) and PCR products were cloned and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL of DNA loading buffer (9157, TAKARA, Kusatsu, Japan) was added to the reaction and incubated at 65 ℃ for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... into 96-well plates containing 2 µL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... After 2 hrs 1µl of Reverse Transcriptase (PrimeScript RT, Takara) was added and reverse transcription was performed at 420C for 1hr followed by inactivation at 700C for 30 mins ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 1x Titanium Taq buffer and 2 μL Titanium Taq (Takara). PCR cycles were ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Developmental Biology 2023Quote: ... fbf-2 cDNA was cloned into the pGBTK vector (Clontech) and transformed into PJ68-4a yeast strain (MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4Δ gal80Δ LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed with 2 × SYBR mix (TaKaRa) in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... NETs were treated with 2 U micrococcal nuclease (Takara Bio) for 10 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... RACE was performed using Advantage 2 Polymerase Mix (Clontech Laboratories). The obtained 5□- and 3□-RACE products were purified using a QIAquick Gel Extraction Kit (QIAGEN) ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Advantage 2 PCR kit (Takara/Clontech Cat # 639207). Libraries were checked for quality and approximate concentration on a 1% agarose gel.
-
bioRxiv - Neuroscience 2024Quote: ... and the Advantage 2 PCR kit (Takara/Clontech Cat # 639207). Libraries were checked for quality and approximate concentration on a 1% agarose gel.
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg of pEGFP-C1 (Takara-bio, discontinued by supplier), and 1.5 μg of bcl-xl/pcDNA3 in 70 μl of DMEM ...
-
bioRxiv - Microbiology 2024Quote: ... and genotyping was performed using advantage 2 polymerase mix (TaKaRa). The genotyping strategies are described in supplementary figures 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Retroviruses encoding a second-generation CAR targeting HER-2 was obtained from the supernatant of the GP+E86 packaging line spun together with T cells onto RetroNectin-coated (10 μg/ml) 6-well plates (Takara Bio) and incubated overnight before the second viral transduction ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adeno-associated virus pseudotype 6 (AAV6) expression vector encoding ARP5 was constructed using AAVpro Helper Free System (AAV6) (TAKARA BIO). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNA was extracted from young seedling tissues (the CK and different GT-KD lines from three different transgenic event were collected and used for total RNA extraction) at 6-DAG with RNAiso Plus (Takara Bio) according to the user manual ...
-
bioRxiv - Biochemistry 2019Quote: ... RT was performed using Oligo(dT) random 6-mer primers from a Prime Script RT Master Mix kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions ...