Labshake search
Citations for Takara Bio :
1451 - 1500 of 2499 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... or with standard (DreamTaq - Thermo Fisher Scientific, or EmeraldAmp Max HS PCR Master Mix - TaKaRa Bio Inc) DNA polymerases ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR reaction mixture included TB Green® Premix Ex Taq™ II (Takara, Shiga, Japan). The qRT-PCR conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide Library PCR Kit (Takara, 632651) and subjected to the high-throughput amplicon sequencing on NextSeq500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first PCR products were subsequently amplified by the nested Per2AS specific primers with Universal Primer (Clontech). The nested PCR products were cloned into pGEM-T vector (Promega ...
-
bioRxiv - Genomics 2019Quote: ... 1 ng full length cDNA was used to perform 35-cycle PCR with Premix Taq™ (TaKaRa). PCR products were purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... using One Step TB Green(tm) PrimeScript(tm) RT-PCR Kit II (SYBR Green) (RR086B, TaKaRa, JAPAN). Relative copy number was determined by calculating the fold-change difference in the gene of interest relative to GAPTH ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplification of the vectors and the FPs was performed using CloneAmp™ DNA polymerase (Clontech, USA). The PCR products were gel purified (Macherey-Nagel ...
-
bioRxiv - Microbiology 2019Quote: ... Outside-in colony PCR of a subset of hpn genes was performed with PrimeSTAR DNA polymerase (TaKaRa) using the following primers:
-
bioRxiv - Biochemistry 2020Quote: ... were replaced by the BG505-NxT or BG505-NxS PCR fragments using the In-Fusion enzyme (Clontech) as described by the manufacturer ...
-
bioRxiv - Pathology 2019Quote: ... An aliquot of the cDNA was mixed with 25 µL SYBR® Green PCR Master Mix (TaKaRa) and 10 pmol of each specific forward and reverse primer ...
-
bioRxiv - Microbiology 2019Quote: ... the cDNA was purified and eluted in 20ul of elution buffer (NucleoSpin PCR Clean-up Kit, Clontech). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The PCR products were extracted from agarose gel using MiniBEST Agarose Gel DNA Extraction Kit (Takara, Japan) based on manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Then cDNA was synthesized according to the protocol of the RT-PCR kit (Takara; Kusatsu, Shiga, Japan) and used as templates for quantitative PCR ...
-
bioRxiv - Genetics 2021Quote: ... and One Step TB Green™ PrimeScript™ RT-PCR Kit II (SYBR Green) (TaKaRa RR086B, Japan).
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Genomics 2020Quote: ... PCR reactions were carried out according to manufacturer’s instructions using either ExTaq polymerase (TaKaRa Bio, Tokyo, Japan) or PCR master mix (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-free cDNA (5μL) was used as a template for PCR with PrimeStar GXL Polymerase (Takara, Japan) and back-to-back PCR primers (LigSeq-F and LigSeq-R ...
-
bioRxiv - Neuroscience 2020Quote: ... The lentiviral genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara).
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed by TB Green® Premix Ex Taq™ □ (Tli RNaseH Plus) (TAKARA, Japan) on the CFX96 Touch™ Real-Time PCR Detection System (BIO-RAD ...
-
bioRxiv - Cell Biology 2021Quote: ... Slc37a2 was amplified by PCR from BMMCs cDNA and inserted into a plEGFP-C1 plasmid (Takara Bio). Slc37a2 plEGFP-C1 plasmid or plasmid vector control were transfected into Amphopack-293 cells (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Q-PCR was carried out using the SYRB Premix Ex Taq™ Perfect Real-Time system (Takara). The expression levels were normalized to that of the housekeeping gene GADPH ...
-
bioRxiv - Microbiology 2020Quote: ... The synthetic sequence was cloned into inversely amplified pSW002-Pc PCR product by infusion cloning (Takara, Z9633N). pSW002-Pc was a gift from Rosemarie Wilton (Addgene plasmid # 108234 ...
-
bioRxiv - Plant Biology 2020Quote: ... Gene specific primers were used to amplify cDNA by PCR using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4-minute denaturation at 95°C followed by 30 to 40 cycles of 30 seconds at 95°C ...
-
bioRxiv - Microbiology 2020Quote: ... the genomic DNA served as a template for PCR with Tks Gflex DNA polymerase (Takara Bio Inc.) using the following primer sets ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR amplification steps were carried out with the PrimeSTAR HS DNA Polymerase (Takara, Otsu, Shigu, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR or qRT-PCR was performed using TB Green® Premix Ex Taq™ II (Takara, Japan). 25S RNA and NbActin2 were used as internal references for DNA and RNA normalization ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The PCR products were sequenced by primer walking and Sanger sequencing with Takara LA Taq (Takara, Japan), a dGTP BigDye Terminator Cycle Sequencing FS Ready Reaction Kit (Thermo) ...
-
bioRxiv - Neuroscience 2020Quote: ... Physical viral titer was determined using either Lenti-X qRT-PCR Titration Kit (Takara, Mountain View, CA) or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara Bio).
-
bioRxiv - Physiology 2021Quote: ... 1 μg RNA was used to synthesize first strand of cDNA using PrimeScriptTM RT-PCR Kit (TaKaRa). qPCR was conducted using PrimeScriptTMRT Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2021Quote: ... Applied Biosystem StepOne real-time PCR system and SYBR Premix Ex Taq II kit (Takara, Dalian, China) were used for the qRT-PCR detection ...
-
bioRxiv - Microbiology 2021Quote: ... RNase H-treated cDNA was used as a template for PCR with PrimeStar GXL Polymerase (Takara, Japan) and primers listed in Supplementary table 7 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and used for first-strand cDNA synthesis using the First-Strand Synthesis System for RT-PCR (Takara). Each sample was processed in triplicate ...
-
bioRxiv - Microbiology 2022Quote: ... Two PCR products were inserted into the vector backbone using In-Fusion HD Cloning Kit (Takara Bio) to generate pLJM1-LTR-FT ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using a SYBR Premix Ex TaqTM kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative PCR reactions were performed using the Takara TP-850 thermal cycler (Takara Bio, Japan, www.takara-bio.com) and THUNDERBIRDTM SYBR® qPCR Mix from Toyobo (https://www.toyobo.co.jp) ...
-
bioRxiv - Molecular Biology 2022Quote: ... And realtime PCR amplification of the cDNAs were performed with SYBR® Premix Ex Taq™ (TAKARA) kit in ABI 7500 realtime-PCR system ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR reactions were performed using a SYBR® Premix Ex Taq™ II Kit (TaKaRa, China) and a CFX96 real-time PCR detection system (BIO-RAD ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative PCR reactions were performed using the Takara TP-850 thermal cycler (Takara Bio, Japan, www.takara-bio.com) and SsoAdvancedTM Universal SYBR® Green Supermix (BIO-RAD ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR was performed for the target genes using SYBR Premier Ex Taq (Takara; Cat No. RR420L) and quantified using the QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative PCR assays were performed on a qTOWER apparatus (Analytic Jena) using SYBR Green master mix (TaKaRa). Gene expression was normalized for the expression of 36B4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR amplified EHMT1-Ankyrin and SET products were then cloned into pEGFPC1 vector (6084-1, Clontech) to generate the plasmid constructs ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... qRT-PCR assays were carried out using the SYBR PrimeScript™ RT reagent Kit (TaKaRa, Kusatsu, Japan) following manufacturer‟s instructions and ABI 7500 Software v2.0.6 (Applied Biosystems ...