Labshake search
Citations for Takara Bio :
1401 - 1450 of 2499 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... AAV was titrated using quantitative PCR (qPCR) with primers for the ITR sequence (TaKaRa Bio Inc).
-
bioRxiv - Neuroscience 2024Quote: ... The titer of AAV was determined with a real-time PCR thermal cycler (Dice, Takara Bio). The resultant AAV1-Syn-mCherry (2.8 × 1012 GC/ml) ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Real-Time PCR was performed by using specific primers and SYBR Green ROX Mix (RR420A, Takara). β-actin was used as the internal quantitative control.
-
bioRxiv - Microbiology 2024Quote: ... The PCR and CPER reaction were performed using PrimeSTAR GXL DNA polymerase (Takara Bio, Cat# R050A). The CPER product was transfected into BHK/hACE2 cells using Lipofectamine LTX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Viral HA segments were PCR-amplified and cloned into pMD-18T vector (6011, TAKARA Beijing, China). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... The HA1 subunit was divided into three fragments for PCR (PrimeSTAR Max DNA Polymerase, Takara Bio), seven Ns and partial sequencing adapters were added in the primer as the barcode ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were constructed by PCR amplification of the whole plasmids with the CloneAmp Hifi polymerase (Takara) and assembly of the insert part with the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Neuroscience 2023Quote: ... Physical and functional titers were obtained using the Lenti-X qRT-PCR Titration Kit (Takara 631235) and qPCR of genomic DNA following HEK293T transduction91 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: PCR reactions were performed using PrimeSTAR® Max DNA Polymerase (TAKARA Bio Inc., San Jose, CA) according to manufacturer protocols ...
-
bioRxiv - Molecular Biology 2023Quote: ... gel purified using the Nucleospin Gel and PCR Clean-Up Kit (TaKaRa Bio Inc., Kusatsu, Japan), and then cloned into the XbaI site of pHIV7/PGK-neo using InFusion cloning (TaKaRa Bio Inc. ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviral titration was performed by RT-qPCR using the Lenti-X qRT-PCR Titration Kit (Takara) and the concentration of lentivirus used for this paper was found to be above 1 × 107 copies / mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... a region spanning the ENE domain was amplified by conventional PCR (PrimeStar HS mix, Takara Bio) with primer sequences listed in Table S9 ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription and quantitative real-time PCR were performed with PrimeScriptTM RT Master Mix (Takara, RR037A) and TB Green Premix Ex TaqTM II (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT-PCR was performed using the Thermal Cycler Dice Real Time System (Takara Bio, Kusatsu, Japan). Primers and templates were mixed with TB Green Premix Ex Taq II (Takara Bio) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed in Thermal Cycler Dice Real Time System Lite (Takara Bio) using KOD SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Plant Biology 2023Quote: ... The full-length CAMTA3 cDNA was PCR amplified using the HS Primestar DNA polymerase (Takara, USA) with forward and reverse primers bearing BamHI and XhoI ...
-
bioRxiv - Genomics 2023Quote: ... Amplified oligonucleotides were purified using the NucleoSpin PCR clean-up and gel extraction kit (Takara Bio). CROP-seq-opti was linearized via digestion with BsmBI and alkaline phosphatase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... while the out/out PCRs were carried out with PrimeSTAR GXL DNA Polymerase (Takara Bio, R051A). Seamless HDR was confirmed by sequencing the junctions between the insert and the mouse genome ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time qPCR amplification was performed using the PrimeScript™ RT-PCR Kit (Takara, Catalog#RR420). Alp ...
-
bioRxiv - Immunology 2023Quote: ... qRT-PCR was performed using the SYBR® Premix Ex Taq™ II (Takara, Shiga, Japan) Kit and a StepOnePlus Real-Time PCR instrument ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA from the total RNA was synthesized using the Advantage® RT-for-PCR kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (RR096A, Takara Bio Inc.), and primer pairs for Zcchc3 (5′-CTCTCTATGCCTTCTTAAACCGA-3′ and 5′-CATCTGCACGCTACAGTTCT-3′ ...
-
bioRxiv - Immunology 2023Quote: ... The viral copies were quantitated by reverse transcription quantitative PCR following the handbook (Takara, Cat.#RR086A). The copy numbers of reverse-transcripts from cell cultures and mice organ samples were normalized with the expression level housekeeping gene of beta-actin by using the 2(-Delta Delta C(T) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was generated from the adapter ligated RNA using the SMARTer PCR cDNA Synthesis Kit (Clontech), replacing the CDS Primer IIA with a custom primer complementary to the 3′ end adapter for first strand synthesis (TableS6) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR for selection cassette production was performed with SeqAmp DNA Polymerase (Takara Bio, cat. no. 63850) using the ultramers as primers and AAT-PB-CD2APtk (Addgene #86004 ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR condition modifications to amplify RACE products are as followed using SeqAmp DNA Polymerase (Takara Bio): Fat1 (TA ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with a Takara Thermal Cycler Dice® Touch (Takara Bio, Kusatsu, Japan). The RT-PCR program was as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral titer was quantified using the Lenti-X™ qRT-PCR Titration Kit (Takara Bio, #631235), according to manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR was performed using TaKaRa PrimeSTAR GXL DNA Polymerase following the manufacturer’s protocol (Takara Biotechnology, Japan). Amplified DNA fragments were purified by illustra ExoProStar (GE Healthcare Life Sciences) ...
-
bioRxiv - Plant Biology 2023Quote: The truncated version of the RPF2nad6 was generated by PCR amplification using Takara PrimeStar polymerase (TaKaRa) and a primer pair designed to remove the last 180 nucleotides of the RPF2nad6 coding sequence representing the RfCTD sequence (Supplementary table 6) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifying PCR of the first stand cDNA product was then performed using SeqAmp DNA Polymerase (Takara) with a nested 3’ primer to the constant genes and a 5’ universal primer based on universal primer sites added to the 5’ end during cDNA generation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The first step of cDNA synthesis was done using the SMARTer PCR cDNA Synthesis Kit (Takara). Then ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription and amplification were performed using One Step PrimeScript™ RT-PCR Kit (Takara, Japan) and reaction performed and visualized using Stratagene Mx3000P qPCR System real-time PCR system (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: The SUGCT coding sequence was amplified by PCR by using PrimeStar GXL polymerase (Takara Bio Inc) using the following primers (start and stop codon in bold) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Mycoplasma contamination in cell cultures was routinely tested using the PCR mycoplasma detection set (Takara Bio). At approximately 70% confluence ...
-
Emerging cooperativity between Oct4 and Sox2 governs the pluripotency network in mouse early embryosbioRxiv - Developmental Biology 2024Quote: ... cDNA was amplified with V3d(T)24 and R2SP primers and Terra PCR Direct Polymerase (Clontech) for 16 cycles ...
-
bioRxiv - Plant Biology 2024Quote: ... and amplified by PCR using Takara Premix Ex TaqTM Hot Start Version (Takara Research, RR030A, Japan). The amplified products were recovered from an agarose gel using a Universal DNA Purification Kit (TIANGEN ...
-
bioRxiv - Cell Biology 2024Quote: The PCR mixtures for the reactions described here were composed using PrimeStar (Takara Bio, Shiga, Japan) with a 2X GC buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... DNA fragments were amplified using PCR using PrimeSTAR® Max DNA Polymerase (Takara Biomedical Technology (Beijing) Co. ...
-
bioRxiv - Developmental Biology 2024Quote: ... Full-length cDNA fragment of human MAK was amplified by PCR using human retinal cDNA (Clontech) as a template and subcloned into the pCAGGSII-2xHA vector (62) ...
-
bioRxiv - Cell Biology 2020Quote: ... FAM111A cDNAs were PCR amplified and inserted into destination vectors using In-Fusion seamless cloning (Takara Bio). The pTRIPz-MycBioID vector allows for doxycycline-inducible expression of RNF4 or FAM111A with N-terminal fusion of a Myc tag and a promiscuous biotin ligase (MycBioID ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2015) with MluI and inserting PCR-amplified EGFP from pEGFP-C1 (Clontech Laboratories, Mountain View, CA, USA). Tol2-mCherry was produced by digesting Tol2-EGFP-C1 with NheI/EcoRI to remove GFP and inserting mCherry amplified by PCR from 8xGliBS-IVS2-mCherry-NLS-polyA-Tol2 (a gift from James Chen (Addgene plasmid #84604) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplifications were typically performed in 20 μL reaction volumes containing 1× EmeraldAmp GT PCR Master Mix (Takara Bio Inc. ...