Labshake search
Citations for Takara Bio :
1451 - 1500 of 1852 citations for 1 Piperidin 4 yl azetidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Genetics 2024Quote: ... 1–1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, CA). For non-cleavable INF2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized from 1 μg of extracted RNA per sample using the SMARTScribe reverse transcriptase (Clontech) and dT primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG T30VN) ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-RFP antibodies (1/1000, RT, overnight, rabbit anti-DsRed, 632496, Takara Bio USA, Madison, WI), followed by Alexa-488 (1/100 ...
-
bioRxiv - Bioengineering 2024Quote: ... Transfer clarified supernatant to fresh container and combine 1 volume of Lenti-X concentrator (TaKaRa; Cat.no: 631232) to 3 volumes of clarified supernatant ...
-
bioRxiv - Neuroscience 2024Quote: ... we performed immuno-staining using primary antibody rabbit anti-dsRed (Takara Bio, Cat. No. 632496, 1:300) and secondary antibody goat anti-rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 ng of RNA was reverse-transcribed using the SMART-Seq v4 Low Input RNA kit (Takara). cDNA were quantified and qualified using Qubit (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was incubated overnight with 1 mL of Talon (immobilized metal affinity chromatography, IMAC) resin (Takara) in the presence of 10 mM imidazole ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 1 μg RNA was reverse-transcribed into cDNA using the PrimeScript RT Reagent Kit (RR037B, Takara). RT-qPCR analysis was conducted using Hieff SYBR Green Master Mix Kit (11201ES08 ...
-
bioRxiv - Cell Biology 2024Quote: ... 250 μL of DNA after sonication were incubated with 1 μL of DNA carrier (ST0029, TakaRa Bio), 25 μL of BSA 5% (BP1600 ...
-
bioRxiv - Genetics 2024Quote: ... Viral supernatant was harvested after 48 hours and concentrated 1:10 using the Lenti-X concentrator (Takara). Concentrated supernatant was resuspended in PBS and stored at -80°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA was isolated from 1 µg total RNA by polyA selection (PrepX polyA 48, Takara Bio 640098) and checked for rRNA contamination using the mRNA 2100 Bioanalyzer chip and protocol (Agilent) ...
-
bioRxiv - Cancer Biology 2021Quote: Full-length cDNA was synthesized from total RNA (1 μg) by SMARTer®□ PCR cDNA Synthesis kit (Clontech) according to the manufacture’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was obtained from 1 µg of total RNA from each sample (Super M-MLV reverse transcriptase, TAKARA) and QPCR was performed using TaqMan™ Gene Expression Master Mix (4369016 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed using Takara PrimeScript™ RT Master Mix (Clontech Laboratories, USA). qRT-PCR was performed on Step One Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Other plasmid components (see Supplementary Table 1) were synthesized or PCR amplified with PrimerSTAR MAX DNA polymerase (TAKARA) and checked by Sanger sequencing ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cDNA was synthesized from 1 μg of total RNA using the PrimeScript™ RT-PCR Kit (Takara). Three technical replicates were measured for gene expression levels in each cDNA sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg each CAS9 guide RNA plasmid (pAS4883 and 4884) and 200 ng linear hygromycin resistance gene (Clontech) were used ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Microbiology 2021Quote: ... pAS1b-HA-TAROR (1-931) or pAS1b-HA-TASOR (630-1512) have been constructed by InFusion technology (Takara) according to the kit manufacture guide ...
-
bioRxiv - Cell Biology 2021Quote: ... First-strand cDNA was synthesized by reverse transcription of 1 μg RNA using PrimeScrip RT Master Mix(Takara). Quantitative real time-PCR was performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription reactions containing 1 μg of total RNA were performed using PrimeScript™ (Takara, Otsu, Shiga, Japan). Individual cDNAs were amplified with THUNDERBIRD™ SYBR qPCR Mix (TOYOBO CO ...
-
bioRxiv - Microbiology 2022Quote: ... KSHV replication in iSLK/Bac16 cells was reactivated by a combination of 1 μg/ml doxycycline (DOX, Clontech) and 1 mM sodium butyrate (Bu ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA synthesis was performed with 1 μg of total RNA using the PrimeScript™ RT Reagent Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: cDNA was generated from 1 μg of total RNA by using the PrimeScript RT Reagent Kit (Takara, Japan) in accordance with the manufacturer’s protocol as previously described [21] ...
-
Airway Gene-Expression Classifiers for Respiratory Syncytial Virus (RSV) Disease Severity in InfantsbioRxiv - Immunology 2020Quote: ... 1 ng of total RNA was amplified using the SMARter Ultra Low amplification kit (Clontech, Mountain View, CA) and libraries were constructed using the NexteraXT library kit (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: cDNA was reverse-transcribed from 1 μg of total RNA using PrimeScript RT reagent (TaKaRa Biotechnology, Shiga, Japan), and 10 ng of cDNA was analyzed using SYBR Premix Ex Taq II (TaKaRa Biotechnology ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plug was incubated in 160 μl of 1× M buffer containing 160 units of Nhe I (TaKaRa) for 7 hr at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of RNA was reverse-transcribed to synthesize complementary DNA by using reverse transcriptase (Takara Bio, Japan) and random hexamer primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1×106 E14 ESCs were transfected with the two appropriate pSPCAs9(Guide)-2A-mCherry vectors using Xfect (Clontech). 48 hours after transfection cells were sorted for high levels of mCherry expression and plated onto 10 cm gelatinized dishes ...
-
bioRxiv - Biochemistry 2022Quote: ... coli codon optimized CHAF1A cDNA was first cloned into a pGEX-6P-1 vector via In Fusion (Takara) (Supplementary Table 3) ...
-
bioRxiv - Immunology 2023Quote: ... and 1 µg was used for cDNA synthesis with the PrimeScript High Fidelity RT-PCR Kit (Takara, R022B). Of the cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... the following primary antibodies were used: rabbit anti-dsRed (1:1,000, Cat.# 632496, Clontech Laboratories, Mountain View, CA), chicken anti-GFP (1:10,000 ...
-
bioRxiv - Plant Biology 2023Quote: The full-length MpACL5 amplified from Tak-1 cDNA by PCR using TaKaRA EX Taq (Takara, Shiga, Japan) with the primers ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized using 1 µg of RNA following manufacturers’ instruction (1st strand cDNA synthesis kit, Takara; 6110A). RT-PCR was performed using SapphireAmp® Fast PCR Master Mix (Takara ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Neuroscience 2022Quote: ... or a rabbit anti-DsRed polyclonal antibody (1:1000, Cat # 632496, RRID:AB_10013483, Takara Bio U.S.A., Inc., CA, U.S.A.). In addition ...
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Neuroscience 2024Quote: ... They were transfected with pAAV, pAAV2/1 (Penn Vector Core, Philadelphia, PA, USA) and pHelper plasmids (Takara Bio)52 ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were incubated with a 1:2000 dilution of an anti-GFP antibody (Clontech 632381, clone JL8) for detection of Clover protein ...
-
bioRxiv - Bioengineering 2023Quote: ... KhES-1 was cultured at feeder-free conditions using StemFit® AK02N (Catalog #RCAK02N, TAKARA BIO, Kusatsu, Japan) with daily medium change ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 ng of RNA was used for the reverse transcription reaction using SMART-seq HT (Takara, 634455). For the PDO xenograft ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...